nucleic acid molecules

专利摘要:
The present invention relates to novel artificial nucleic acid molecules encoding at least one antigenic peptide or protein and at least one additional sequence preferably targeting antigenic peptides or proteins to cellular compartments of interest. Furthermore, the invention provides (pharmaceutical) compositions or vaccines and kits comprising said nucleic acid molecules. Nucleic acid molecules, (pharmaceutical) compositions or vaccines and kits are useful for treating a variety of diseases, such as cancer, infectious diseases, autoimmune diseases, allergies, or host versus graft disease.
公开号:BR112019028280A2
申请号:R112019028280-7
申请日:2018-07-03
公开日:2020-07-14
发明作者:Mariola Fotin-Mleczek；Katja Fiedler；Aleksandra KOWALCZYK；Regina HEIDENREICH
申请人:Curevac Ag；
IPC主号:

专利说明:

[0001] [0001] Unlike conventional protein-based vaccines, nucleic acid vaccines are based on nucleic acid molecules - DNA or RNA - encoding vaccine antigens. DNA vaccines typically consist of antigen-encoding gene(s) inserted into a bacterial plasmid under the control of a eukaryotic promoter, whereas RNA vaccines can usually employ messenger RNAs (mMRNA) or other RNA molecules that encode antigens. Like protein vaccines, nucleic acid vaccines can be delivered via a variety of different routes, including intramuscular, subcutaneous, mucosal, or transdermal delivery. However, unlike protein antigens, the nucleic acid vaccine to be effective must enter the cytoplasm of cells at the site of injection in order to induce antigen expression in vivo, thus allowing the presentation of the antigen on the antigen molecules. major histocompatibility complex (MHC) and T cell recognition (Li and Petrovsky Expert Rev Vaccines. 2016; 15(3):313-329, McNamara et al., J. Inmunol Res. 2015; 2015: 794528).
[0002] [0002] DNA vaccines are administered to the host and internalized by host cells, where the antigen-encoding DNA plasmid is transcribed in the nucleus and translated in the cytoplasm by cellular mechanisms of the host. Unlike DNA vaccines, antigen-encoding mRNAs only need to enter the cytoplasm, where translation takes place, in order to transfect a cell. In any case, the resulting proteins are processed into peptides, which are finally presented on the surface of the host cells in the context of the molecules of the main etiology complex 870190141603, of 12/30/2019, p. 21850/22358 histocompatibility (MHC). The peptide-MHC complex is recognized by antigen-specific T cells, resulting in a cellular host immune response (McNamara et al. J Inmunol Res. 2015; 2015:794528).
[0003] [0003] There are two ramifications of the MHC receptor presentation. MHC class molecules | - abundantly expressed in all nucleated cells and also in platelets - bind endogenously produced peptides, including viral peptides and tumor antigens in the endoplasmic reticulum (ER). Specifically, MHC class | present peptides that result from the proteolytic cleavage of endogenous proteins. Cleaved peptide fragments bind to an antigen peptide transporter (TAP) of the endoplasmic reticulum (ER), where they are further cleaved from N-terminal residues and then bind to MHC class | (Murphy K (2011) Janeways Immunobiology. New York: Garland Science).
[0004] [0004] In contrast, class I MHC molecules are expressed predominantly by professional antigen-presenting cells (APCs) such as macrophages, B cells, and especially dendritic cells (DCs). Class II MHC molecules acquire their peptides from antigens endocytosed in endocytic vesicles. Specifically, class l molecules mainly contain peptides from exogenous or plasma membrane proteins that are taken up by APCs during the course of endocytosis. Antigen is processed through a series of endosomal compartments with a denaturing environment and a set of proteolytic and denaturing enzymes (Bryant et al. Adv. Immunol. 2002; 80:71-114). As the largest proportion of class I MHC epitopes are generated by cleavage and processing of peptides by endosomal and lysosomal proteases, class II MHC epitopes are primarily derived from endocytosed proteins and antigens, which reside in 'edition 870190141603 , of 12/30/2019, p. 21851/22358 or move through the endocytic pathway. Proteins without direct access to the endocytic pathway (eg, antigens naturally located in the cytoplasm, in non-endocytic organelles, or in the nucleus) are generally poorly presented in the context of MHC class |1.
[0005] [0005] Antigen/MHC complexes are recognized by T lymphocytes carrying the antigen-specific TCRs (T cell receptors). Antigenic peptides presented in an MHC class context | are recognized by CD8+ cytotoxic T lymphocytes (CTLs), while complexes of antigenic peptides and class II MHC molecules are recognized by CD4+ T helper cells. Although CD8+ CTLs mediate important cell-mediated effector functions, including cytotoxic activity targeting cancerous or virus-infected cells, CD4+ T helper cells play a key role in orchestrating CTL effector functions and production. of antibodies. Nucleic acid vaccines have many advantages over traditional peptide/protein vaccines, with vaccine design being simple, thus reducing cost and production time. In addition, nucleic acid vaccines allow for the easy delivery of multiple antigens with one immunization and can induce both humoral and cellular immune responses, which makes tumor/pathogen escape less likely. Furthermore, unlike peptide-based vaccines, nucleic acid-based vaccines are not restricted by the patient's HLA type. Furthermore, in vivo expression of an antigen and endogenous post-translational modification results in native protein structures, ensuring immune presentation and adequate processing. From a safety point of view, cloning or nucleic acid synthesis, rather than having to purify proteins from pathogens, avoids the need to use pathogenic microorganisms in vaccine manufacturing, making nucleic acid vaccines generally safe and tolerable. 'edition 870190141603, of 12/30/2019, page 21852/22358
[0006] [0006] Despite their promising features, DNA vaccines have been found to elicit less immune response than other types of vaccines, including peptide vaccines, cellular vaccines, viral vector vaccines, and RNA vaccines. The relatively low immunogenicity of DNA vaccines combined with concerns about their potential for oncogenesis via integration into the host genome makes RNA-based vaccines particularly attractive. However, antigens encoded by RNA vaccines are typically translated in the cytoplasm and degraded by proteasomes, resulting predominantly in MHC class | to CD8+ T cells. To promote CTL-mediated immune responses, or to induce antibody production, further stimulation of a productive helper T cell response via the MHC class II pathway would be highly desirable (McNamara et al. J Immunol Res. 2015; 2015: 794528).
[0007] [0007] Different strategies were tested in preclinical models to explore the therapeutic potential of nucleic acid vaccines, including new plasmid vectors and codon optimization to improve antigen expression, new gene transfection systems or electroporation to increase delivery efficiency, booster regimens of live virus or protein vectors to maximize immune stimulation, and formulation of nucleic acid vaccines with traditional or molecular adjuvants (Li and Petrovsky Expert Rev Vaccines. 2016; 15 ( 3): 313—329). Several studies have demonstrated that the addition of a lysosomal targeting signal to the antigen coding sequence can result in a productive helper T cell response. In addition, tumor antigen mRNAs fused to a signal peptide and an HLA class |1 classification can 'edition 870190141603, 12/30/2019, p. 21853/22358 result in HLA class filing | and 11 (VO200212281; Marks et al. 1995 J Cell Biol. 1995; 131:351—369; Kreiter et al. 2007 J Immunol. Jan 1, 2008; 180(1):309-18 ). Diebold et al. (Gene Ther. 2001 Mar; 8(6):487-93) demonstrated that dendritic cells expressing cDNA as transferrin receptor (TIR) or invariant chain fusions were able to generate MHC-specific immune responses. class II, plus MHC class | responses. Kreiter et al. (J Immunol. Jan 1, 2008; 180(1):309-18) reported that the combination of an N-terminal leader peptide with an MHC class | (MITD) attached to the C-terminus of an RNA-encoded antigen strongly improves the presentation of MHC class epitopes | and class I in human and murine dendritic cells (DCs).
[0008] [0008] In the two decades since their discovery, nucleic acid vaccine technologies have come a long way. However, there is still a lack of effective strategies to increase CD8+ and CD4+ T cell responses and thus enhance the therapeutic or prophylactic efficacy of nucleic acid-based vaccines.
[0009] [0009] Boyle et al. (Nature. March 26, 1998; 392(6674):408-11), Deliyannis et al. (Proc Natl Acad Sci USA. June 6, 2000; 97(12):6676-80 ) and Xu et al. (J Gene Med. 2009 abr;11(4):354-60) describe DNA vaccines that encode fusion proteins with extracellular domains of CTLA4. These extracellular domains specifically target the Kall fused antigens.
[0010] [0010] It is an object of the present invention to meet the needs of the art and provide improved therapeutic approaches for the treatment of the diseases specified herein. The object underlying the present invention is solved by the claimed object, among others, providing nucleic acids that encode fusion proteins with functional transmembrane domains for better "loading" of 'edition 870190141603, of 12/30/2019, page 21854/22358 MHC-I and MHC-II antigens in the respective cell compartments.
[0011] [0011] While the present invention is described in detail below, it should be understood that this invention is not limited to the specific methodologies, protocols, and reagents described herein, as these may vary. It is also to be understood that the terminology used herein is not intended to limit the scope of the present invention, which will be limited only by the appended claims. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as are commonly understood by one skilled in the art.
[0012] [0012] In the following, the elements of the present invention will be described. These elements are listed with specific modalities, however, it should be understood that they can be combined in any way and in any number to create additional modalities. The various examples and preferred embodiments described are not to be interpreted to limit the present invention only to the explicitly described embodiments. This description should be understood as supporting and encompassing modalities that combine the modalities explicitly described with any number of the preferred and/or disclosed elements. In addition, any permutations and combinations of all elements described in this application are to be considered disclosed by the description of the present application, unless the context indicates otherwise.
[0013] [0013] Throughout this report and the claims that follow, unless the context requires otherwise, the term "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a declared member, integer or step, but not the exclusion of any other undeclared member, integer or step. The term "consist of" is an issue 870190141603, dated 12/30/2019, p. 21855/22358 specific modality of the term "comprise", in which any other undeclared member, integer or step is excluded. In the context of the present invention, the term "comprise" encompasses the term "consist of". The term "comprising" thus encompasses "including" as well as "consisting", e.g. a composition "comprising" X may consist exclusively of X or may include something additional, e.g. X + Y.
[0014] [0014] The terms "a" and "the" and similar reference used in the context of describing the invention (especially in the context of the claims) shall be interpreted to encompass both the singular and the plural, unless otherwise indicated. otherwise here or clearly contradicted by the context. The citation of ranges of values here is only intended to serve as a shorthand method of individually referring to each separate value within the range. Unless otherwise stated in this document, each individual value is incorporated in the report as if it were cited here individually. No language in the report should be interpreted as indicating any unclaimed element essential to the practice of the invention.
[0015] [0015] The word "substantially" does not exclude "completely", for example a composition that is "substantially free" of Y may be completely free of Y. Where necessary, the word "substantially" may be omitted from the definition of invention.
[0016] [0016] The term "about" in relation to a numerical value x means x + 10%.
[0017] [0017] In the present invention, if not otherwise indicated, different alternative features and modalities can be combined with each other.
[0018] [0018] For clarity and readability, the following definitions are provided. Any technical characteristic mentioned for these definitions can be read in each of the modalities of the notification 870190141603, of 12/30/2019, p. 21856/22358 vention. Additional definitions and explanations may be specifically provided in the context of these modalities. Definitions
[0019] [0019] Artificial Nucleic Acid Molecule: An artificial nucleic acid molecule can typically be considered a nucleic acid molecule, eg a DNA or an RNA, which does not occur naturally. In other words, an artificial nucleic acid molecule can be considered an unnatural nucleic acid molecule. Such a nucleic acid molecule may be unnatural due to its individual sequence (which does not occur naturally) and/or due to other modifications, for example, structural nucleotide modifications, which do not occur naturally. An artificial nucleic acid molecule can be a DNA molecule, an RNA molecule, or a hybrid molecule comprising portions of DNA and RNA. Typically, artificial nucleic acid molecules can be designed and/or generated by genetic engineering methods to match a desired artificial sequence of nucleotides (heterologous sequence). In this context, an artificial sequence is generally a sequence that cannot occur naturally, i.e., differs from the wild-type sequence by at least one nucleotide. The term "wild type" can be considered a sequence that occurs in nature. Furthermore, the term "artificial nucleic acid molecule" is not restricted to mean "a single molecule", but is typically considered to comprise a set of identical molecules. Therefore, it can refer to a plurality of identical molecules contained in an aliquot.
[0020] [0020] DNA: DNA is the usual abbreviation for deoxyribonucleic acid. It is a nucleic acid molecule, that is, a polymer made up of nucleotides. These nucleotides are generally deoxy-adenosine-monophosphate, deoxy-thymidine-monophosphate monomers, deoxyethylation 870190141603, dated 12/30/2019, p. 21857/22358 xi-guanosine-monophosphate and deoxy-cytidine-monophosphate which are themselves composed of a sugar (deoxyribose) moiety, a base moiety and a phosphate moiety, polymerized by a characteristic backbone structure. The backbone structure is typically formed by phosphodiester bonds between the sugar portion of the nucleotide, ie, deoxyribose, of a first and a phosphate portion of an adjacent second monomer. The specific order of the monomers, that is, the order of the bases attached to the sugar/phosphate backbone, is called the DNA sequence. DNA can be single-stranded or double-stranded. In the double-stranded form, first strand nucleotides typically hybridize to second strand nucleotides, for example, by A/T base pairing and G/C base pairing.
[0021] [0021] Heterologous sequence: Two sequences are typically understood to be “heterologous” if they are not derivable from the same gene. That is, although heterologous sequences may be derived from the same organism, they naturally (in nature) do not occur in the same nucleic acid molecule, such as in the same mRNA.
[0022] [0022] Cloning site: A cloning site is typically understood as a segment of a nucleic acid molecule, which is suitable for insertion of a nucleic acid sequence, for example, a nucleic acid sequence comprising a quan- open reading dro. Insertion may be performed by any molecular biological method known to those skilled in the art, for example, by restriction and ligation. A cloning site typically comprises one or more restriction enzyme recognition sites (restriction sites). These one or more restriction sites can be recognized by restriction enzymes that cleave DNA at these sites. A cloning site that comprises more than one restriction site can also be called a multiple cloning site (MCS) 'edition 870190141603, dated 12/30/2019, p. 21858/22358 or polyligand.
[0023] [0023] Nucleic acid molecule: A nucleic acid molecule is a molecule comprising, preferably consisting of, nucleic acid components. The term nucleic acid molecule preferably refers to DNA or RNA molecules. It is preferably used synonymously with the term "polynucleotide". Preferably, a nucleic acid molecule is a polymer comprising or consisting of nucleotide monomers, which are covalently linked together by phosphodiester bonds of a sugar/phosphate backbone. The term "nucleic acid molecule" also includes modified nucleic acid molecules, such as base-modified, sugar-modified, or backbone-modified DNA or RNA molecules.
[0024] [0024] Open reading frame: An open reading frame (ORF) in the context of the invention can typically be a sequence of several nucleotide triplets, which can be translated into a peptide or protein. An open reading frame preferably contains a start codon, that is, a combination of three subsequent nucleotides that generally encode the amino acid methionine (ATG), at its 5' end, and a subsequent region, which normally encodes the amino acid methionine (ATG). mally exhibits a length that is a multiple of 3 nucleotides. An ORF is preferably terminated by a stop codon (eg TAA, TAG, TGA). Typically, this is the only open reading frame stop codon. Thus, an open reading frame in the context of the present invention is preferably a nucleotide sequence, consisting of a number of nucleotides that can be divided by three, that begins with a start codon (e.g., ATG) and that normally ends with a stop codon (eg TAA, TGA or TAG). The open reading frame can be isolated or incorporated into a nucleic acid sequence 'edition 870190141603, dated 12/30/2019, p. 21859/22358 longer, for example, in a vector or an mRNA. An open reading frame may also be termed "(protein) coding sequence" or, preferably, "coding sequence".
[0025] [0025] Peptide: A peptide or polypeptide is typically a polymer of amino acid monomers, linked by peptide bonds. Typically contains less than 50 monomer units. However, the term peptide is not a disclaimer for molecules with more than 50 monomer units. Long peptides are also called polypeptides, typically having between 50 and 600 monomer units.
[0026] [0026] Polyvalent/Multivalent Composition: The terms "polyvalent composition" or "multivalent composition" will be recognized and understood by the person skilled in the art and are intended, for example, to refer to a composition or a vaccine comprising different antigens or epitopes of different antigens, or comprising different epitopes of the same antigen, or any combination thereof. The terms describe that said vaccine or composition has more than one valence. In the context of the invention, a polyvalent cancer vaccine would comprise at least one artificial nucleic acid molecule, for example antigenic peptides or proteins encoding RNA derived from several different antigens or encoding different epitopes of the same antigen, or a combination thereof.
[0027] [0027] Protein: A protein typically comprises one or more peptides or polypeptides. A protein is typically folded into a three-dimensional shape, which may be necessary for the protein to perform its biological function.
[0028] [0028] Restriction site: A restriction site, also called restriction enzyme recognition site, is a nucleotide sequence recognized by a restriction enzyme. A site of 'edition 870190141603, of 12/30/2019, p. The restriction is typically a short, preferably palindromic, nucleotide sequence, for example, a sequence comprising 4 to 8 nucleotides. A restriction site is preferably specifically recognized by a restriction enzyme. The restriction enzyme typically cleaves a nucleotide sequence comprising a restriction site at this site. In a double-stranded nucleotide sequence, such as a double-stranded DNA sequence, the restriction enzyme typically cuts both strands of the nucleotide sequence.
[0029] [0029] RNA, mRNA: RNA is the usual abbreviation for ribonucleic acid. It is a nucleic acid molecule, that is, a polymer made up of nucleotides. These nucleotides are usually adenosine-monophosphate, uridine-monophosphate, guanosine-monophosphate, and cytidine-monophosphate monomers that are connected to each other along a so-called backbone. The backbone is formed by phosphodiester bonds between the sugar, that is, ribose, of a first and a phosphate moiety of an adjacent second monomer. The specific sequence of monomers is called the RNA sequence. Generally, RNA can be obtained by transcribing a DNA sequence, for example, inside a cell. In eukaryotic cells, transcription is typically carried out within the nucleus or mitochondria. /n vivo, DNA transcription often results in so-called premature RNA being processed into so-called messenger RNA, often abbreviated as mMRNA. Processing of premature RNA, for example in eukaryotic organisms, comprises a variety of different post-transcriptional modifications, such as splicing, 5' capping, polyadenylation, export of the nucleus or mitochondria, and the like. The sum of these processes is also called RNA maturation. Mature messenger RNA usually provides the nucleotide sequence that can be translated into a sequence 'edition 870190141603, dated 12/30/2019, p. 21861/22358 amino acid of a particular peptide or protein. Typically, a mature mRNA comprises a 5'-cap, a 5-UTR, an open reading frame, a 3-UTR and a poly(A) sequence.
[0030] [0030] The artificial RNA, preferably the mMRNA of the invention, can be prepared using any method known in the art, including chemical synthesis, such as, for example, solid-phase RNA synthesis, as well as in vitro methods, such as RNA in in vitro transcription reactions.
[0031] [0031] In vitro RNA transcription/in vitro transcription: The terms "in vitro RNA transcription" or "in vitro transcription" refer to a process where RNA is synthesized in a cell-free system (in vitro). DNA, particularly plasmid DNA (or PCR product), is commonly used as a template for generating RNA transcripts. RNA can be obtained by in vitro DNA-dependent transcription of an appropriate DNA template, which, in accordance with the present invention, is preferably a linearized plasmid DNA template. The promoter for controlling transcription in vitro can be any promoter for any DNA-dependent RNA polymerase. Particular examples of DNA-dependent RNA polymerases are the T7, T3 and SP6 RNA polymerases. A DNA template for in vitro transcription of RNA can be obtained by cloning a nucleic acid, in particular, the cDNA corresponding to the respective RNA to be transcribed in vitro, and introducing it into an appropriate vector for in vitro transcription, for example , on plasmid DNA. In a preferred embodiment of the present invention, the DNA template is linearized with a suitable restriction enzyme before being transcribed in vitro. CcDNA can be obtained by reverse transcription of mRNA or chemical synthesis. Furthermore, the DNA template for in vitro RNA synthesis can also be obtained by gene synthesis.
[0032] [0032] Reagents used in in vitro RNA transcription include publication 870190141603, of 12/30/2019, p. 21862/22358 in typically: a DNA template (linearized plasmid DNA or PCR product) with a promoter sequence that has a high binding affinity for its respective RNA polymerase, such as bacteriophage-encoded RNA polymerases (T7, T3, SP6, or Syn5); ribonucleotide triphosphates (NTPs) for the four bases (adenine, cytosine, guanine and uracil); optionally, a cap analog as defined herein (e.g., m7G(5')ppp(5')G(m7G)); optionally, other modified nucleotides as defined herein; a DNA-dependent RNA polymerase capable of binding to the promoter sequence within the DNA template (eg, T7, T3, SP6, or Syn5 RNA polymerase); optionally, a ribonuclease (RNase) inhibitor to inactivate any contaminating RNase; optionally, a pyrophosphatase to degrade the pyrophosphate, which can inhibit transcription; MgCl2, which provides Mg2+ ions as a cofactor for polymerase; a buffer (TRIS or HEPES) to maintain an adequate pH value, which may also contain antioxidants (e.g. DTT), and/or polyamines such as spermidine in optimal concentrations, or a buffer system as disclosed in WO2017 /109161.
[0033] [0033] In the context of nucleic acid vaccine production, it may be necessary to provide GMP grade RNA. GMP grade RNA can be properly produced using a manufacturing process approved by regulatory authorities. Therefore, in a particularly preferred modality, RNA production is carried out under current good manufacturing practices (GMP), implementing various quality control steps at the DNA and RNA level, according to WOZ2016/ 180430. Consequently, the RNA of the invention is a GMP grade RNA, particularly a GMP grade RNA mRNA.
[0034] [0034] The RNA products obtained are preferably purified using PureMessengerO (CureVac, Túbingen, Germany; RP-'edition 870190141603, of 12/30/2019, page 21863/22358
[0035] [0035] Sequence of a nucleic acid molecule: The sequence of a nucleic acid molecule is typically understood as the individual and particular order, that is, the succession of its nucleotides. The sequence of a protein or peptide is typically understood as the order, that is, the succession of its amino acids.
[0036] [0036] Sequence Identity: Two or more sequences are identical if they exhibit the same length and order of nucleotides or amino acids. Percent identity typically describes the extent to which two sequences are identical, that is, it typically describes the percentage of nucleotides that match in their sequence position with identical nucleotides of a reference sequence. To determine the degree of identity ("% identity), the sequences to be compared are typically considered to have the same length, that is, the length of the longest sequence of the sequences to be compared. This means that a first sequence composed of 8 nucleotides is 80% identical to a second sequence composed of 10 nucleotides comprising the first sequence.In other words, in the context of the present invention, sequence identity preferably refers to the percentage of nucleotides or amino acids of a sequence that have the same position in two or more sequences of the same length. Specifically, the "% identification 870190141603, of 12/30/2019, p. The quality" of two amino acid sequences or two nucleic acid sequences can be determined by aligning the sequences for optimal comparison purposes (e.g., gaps can be introduced in both sequences for better alignment with the other sequence) and comparing the amino acids or nucleotides at the corresponding positions. Gaps are generally considered non-identical positions, regardless of their current position in an alignment. The "best alignment" is typically an alignment of two sequences that results in the highest percent identity The percent identity is determined by the number of identical nucleotides in the sequences being compared (ie, % identity = A of identical positions/total positions x 100). Determining the percent identity between two sequences can be performed using an algorithm mathematician known to those skilled in the art.
[0037] [0037] Stabilized nucleic acid molecule: A stabilized nucleic acid molecule is a nucleic acid molecule, preferably a DNA or RNA molecule that is modified so that it is more stable to disintegration or degradation, for example, by environmental factors or enzymatic digestion, such as by exo- or endonuclease degradation, than the nucleic acid molecule without the modification. Preferably, a nucleic acid molecule stabilized in the context of the present invention is stabilized in a cell, such as a prokaryotic or eukaryotic cell, preferably, in a mammalian cell, such as a human cell. The stabilizing effect can also be exerted outside the cells, for example in a buffer solution etc., for example in a manufacturing process for a pharmaceutical composition comprising the stabilized nucleic acid molecule.
[0038] [0038] Transfection: The term "transfection" refers to the introduction 'edition 870190141603, dated 12/30/2019, p. 21865/22358 of nucleic acid molecules, such as DNA or RNA molecules (eg, mRNA), in cells, preferably in eukaryotic cells. In the context of the present invention, the term "transfection" encompasses any method known to the skilled person for introducing nucleic acid molecules into cells, preferably eukaryotic cells, such as mammalian cells. Such methods encompass, for example, electroporation, lipofection, for example based on cationic lipids and/or liposomes, calcium phosphate precipitation, nanoparticle based transfection, virus based transfection or transfection based on cationic polymers such as DEAE- dextran or polyethyleneimine etc. Preferably, the introduction is non-viral.
[0039] [0039] Vector: The term "vector" refers to a nucleic acid molecule, preferably an artificial nucleic acid molecule. A vector in the context of the present invention is suitable for incorporating or harboring a desired nucleic acid sequence, such as a nucleic acid sequence comprising an open reading frame. Such vectors can be storage vectors, expression vectors, cloning vectors, transfer vectors, etc. A storage vector is a vector that allows for the convenient storage of a nucleic acid molecule, for example an mRNA molecule. Thus, the vector may comprise a sequence corresponding to, for example, a desired mRNA sequence or a part thereof, such as a sequence corresponding to the coding sequence and the 3-UTR of an mRNA. An expression vector can be used for the production of expression products, such as RNA, eg mRNA, or peptides, polypeptides or proteins. For example, an expression vector may comprise the sequences necessary for transcription of a sequence extension of the vector, such as a promoter sequence, for example, 'edition 870190141603, of 12/30/2019, p. 21866/22358 an RNA polymerase promoter sequence. A cloning vector is typically a vector that contains a cloning site, which can be used to incorporate nucleic acid sequences into the vector. A cloning vector can be, for example, a plasmid vector or a bacteriophage vector. A transfer vector may be a vector that is suitable for transferring nucleic acid molecules into cells or organisms, for example, viral vectors. A vector in the context of the present invention can be, for example, an RNA vector or a DNA vector. Preferably, a vector is a DNA molecule. Preferably, a vector within the meaning of the present application comprises a cloning site, a selection marker, such as an antibiotic resistance factor, and a sequence suitable for multiplication of the vector, such as an origin of replication.
[0040] [0040] Vehicle: A vehicle is typically understood as a material suitable for storing, transporting and/or administering a compound, such as a pharmaceutically active compound. For example, it may be a physiologically acceptable liquid suitable for storing, transporting and/or administering a pharmaceutically active compound.
[0041] [0041] This application is filed together with a sequence listing in electronic format, which forms part of the description of this application (WIPO ST.25 standard). The information contained in the electronic format of the sequence listing filed with this application is incorporated herein by reference in its entirety. Where reference is made herein to a "SEQ ID NO:", the corresponding nucleic acid sequence or amino acid (aa) sequence in the sequence listing having the respective identifier is referred to. For many sequences, the sequence listing also provides additional detailed information, for example about certain structural features, optimizations 'edition 870190141603, 12/30/2019, p. 21867/22358 of sequences, GenBank identifiers or their encoding capability. In particular, this information is provided under the numeric identifier <223> in the WIPO ST.25 standard sequence listing. For example, information provided under said numerical identifier <223> is explicitly included in this document in its entirety and should be considered an integral part of the description of the underlying invention.
[0042] [0042] The present invention is based, in part, on the surprising discovery that the fusion of antigens with suitable "targeting" sequences derived from a group of signal transduction proteins involved in advantageously targeted immune responses. in these antigens to MHC class processing compartments | and MHC class II. Such "targeting" sequences preferably comprise or consist of transmembrane domains. Proteins (e.g., CTLA4) containing the "targeting" sequences employed are expressed on the outside of plasma membranes, and are typically "fast recycling" proteins that are readily and recurrently internalized to enter endosomal pathways, which preferentially cross the MHC class | and, in particular, also the MHC class II pathways. The "targeting" approach of the present invention is therefore different from other prior art approaches in that it preferentially targets antigens to desired intracellular pathways rather than to certain cell types.
[0043] [0043] For effective delivery of antigenic sequences to MHC class processing compartments | and class I MHC, nucleic acid molecules can be engineered to encode antigens/epitopes that are fused to amino acid sequences derived from rapidly recycling proteins residing in the plasma membrane. Targeting can be achieved using the 'edition sequence 870190141603, dated 12/30/2019, pg. 21868/22358 full-length amino acid of a protein, or preferably its transmembrane (and optionally cytoplasmic) domains, preferably in conjunction with an appropriate signal peptide. The fusion of these sequences with the antigenic peptide or protein of interest preferentially facilitates the localization of the antigens/epitopes to the plasma membrane, and their recycling to the cellular compartments where the processing and loading of MHC class | and II, such as the endoplasmic reticulum, endosomes or lysosome. The unprecedented targeting strategy presented here exploits the rapid recycling characteristics conferred by the amino acid sequences (in particular, the transmembrane domains) derived from the group of resident immune response activation signal transduction proteins (SIRSTepm) in the plasma membrane of immune cells. By effectively forwarding antigenic peptides or proteins to the plasma membrane and anchoring them in the same and subsequent recycling to cellular compartments that intersect with the MHC processing and loading pathways through the MHC domains. Fused IRSTepm Derived Proteins, Class MHC Encoded Antigen/Epitope Presentation | and class I MHC in recipient cells, and therefore the induction of antigen-specific immune responses against immunogenic epitopes or whole antigens by nucleic acid-based vaccines is preferentially elevated. The targeted approach presented here exploits the common pathways of rapid recycling of membrane-bound IRSTepm proteins, rather than using state-of-the-art approaches to target the translated antigenic proteins or peptides directly into the endosomal/lysosomal compartments through the fusion of different trafficking sequences. .
[0044] [0044] To that end, the present inventors have generated molecules 'etition 870190141603, of 12/30/2019, p. 21869/22358 nucleic acid encoding such antigenic fusion proteins and investigated their therapeutic potential in a tumor model. Therefore, proteins, peptides or antigenic epitopes of interest have been associated with selected domains or full-length proteins derived from various signal transduction proteins activating the rapidly recycling immune response. Typically, nucleic acid constructs were designed by removing the extracellular domain from the protein and replacing it with the antigen/epitope. Signal peptides and transmembrane domains can be included to optimize transport to and docking at the external site of the plasma membrane. Additionally, suitable ligands were introduced to allow the correct presentation of immunogenic peptides by MHC class | and class II. Helper T cell epitopes can be included to enhance the induction of antigen-specific immune responses against the encoded epitopes. The design strategy allowed targeting specific epitopes or antigens to cellular compartments enriched with MHC class | and class |l.
[0045] [0045] Surprisingly, antigenic fusion proteins were able to effectively induce antigen-specific T cell responses, and were shown to efficiently reduce tumor growth in a mouse model.
[0046] [0046] The novel targeting approach presented in this document provides a convenient and effective means to preferentially ensure antigen entry into MHC processing pathways. Thus, said targeting strategy preferentially enhances the induction of antigen-specific immune responses against proteins or antigens or antigenic epitopes and opens new possibilities for high therapeutic efficacy of nucleic acid vaccines.
[0047] [0047] In a first aspect, the present invention relates to an artificial nucleic acid molecule comprising at least one coding region encoding a. at least one antigenic peptide or protein, and b. at least one additional amino acid sequence derived from at least one immune response signal transducing protein located in the outer plasma membrane, as defined below. Preferably, said at least one additional amino acid sequence comprises or consists of at least one transmembrane domain of said protein. Without wishing to be bound by a specific theory, it is predicted that at least one additional amino acid sequence derived from at least one immune response signal transduction protein located in the outer plasma membrane (also referred to as "IRSTepm in this document) provides a better efficiency of MHC class I and II presentation, preferably resulting in simultaneous stimulation and expansion of CD8+ and CD4+ T cell subsets.
[0048] [0048] The artificial nucleic acid molecule of the invention -which may preferably be an RNA as described below- thus encodes at least one amino acid sequence derived from IRS-Tepm (which is preferably selected on the basis of its ability to targeting fused amino acid sequences to desired MHC processing and loading compartments) and at least one antigenic peptide or protein (which is preferably selected based on the particular disease or condition to be treated or prevented).
[0049] [0049] Both are typically expressed as a fusion protein, which is also referred to as "antigenic fusion protein in this document". As described below, the artificial nucleic acid molecules, preferably RNAs, of the invention can encode antigenic polypeptide constructs comprising various selection 870190141603, of 12/30/2019, p. 21871/22358 amino acid sequences derived from IRSTepm (identical or different), various antigenic peptides or proteins (identical or different), and optionally further (poly-)peptides, proteins or protein domains (such as signal peptides, peptide linkers and T helper epitopes) in any combination disclosed herein. However, it is envisioned that the artificial nucleic acid molecule, preferably RNA, of the invention encodes an "antigenic polypeptide construct" comprising at least one antigenic peptide or protein, and at least one additional derived amino acid sequence. from IRSTEpm. Coding Region Amino acid sequence derived from IRSTepm
[0050] [0050] The present inventors have surprisingly found that fusion of antigenic peptides or proteins to appropriate targeting sequences derived from immune response activation signal transduction proteins located on the outer plasma membrane ("IRSTepm") effectively mediates the presentation of MHC, preferentially resulting in elevated T cell responses. Without wishing to be bound by a specific theory, the amino acid sequence derived from IRSTepm may preferably comprise targeting sequences that mediate translocation into defined subcellular MHC processing and loading compartments, resulting in increased MHC class | and class | of antigenic peptides and proteins fused to it.
[0051] [0051] The term "immune response activation signal transduction" refers to the cascade of processes by which a signal interacts with a receptor, causing a change in the level or activity of a second messenger or other downstream target, and ultimately leading to the activation or perpetuation of an immune response. The term "IRSTepm protein" therefore refers to the proteins located in the membrane 'etition 870190141603, dated 12/30/2019, p. 21872/22358 plasma membrane, that is, to the leaflet of the plasma membrane that faces the cytoplasm, which is involved in these signaling cascades. IRSTepm proteins are therefore preferentially expressed in the plasma membrane of immune cells, more preferentially of antigen-presenting cells (APCs). It is recognized that, due to the complexity of intracellular signaling pathways, the term IRSTepm protein may include proteins having two functions in the regulation of immune responses and which have inhibitory and activating effects in different configurations. Preferred IRSTepm proteins are listed in Table 1 below. Preferably, the "IRS-Tepm proteins" are rapidly recycled at the cell surface.
[0052] [0052] As explained above, the artificial nucleic acid molecules of the invention comprise at least one amino acid sequence "derived from" at least one IRSTepm protein, as defined herein.
[0053] [0053] The term "derived from", as used herein, generally indicates that a sequence can be isolated from, related to, based on, or homologous to a reference sequence. Sequences that are "derived from" a reference sequence, therefore, include sequences that are identical to said reference sequence (i.e., full-length sequences exhibiting 100% sequence identity to said reference sequence). reference), as well as variants, fragments and derivatives of said reference sequences. The definition is applicable to both amino acid sequences and nucleic acid sequences, mutatis mutandis.
[0054] [0054] Artificial nucleic acid molecules, preferably RNAs, of the invention preferably encode, in their at least one coding region, at least one amino acid sequence derived from an IRSTepm protein, as described in this document, or a fragment, variant or derived from any of the references 'edition 870190141603, of 12/30/2019, p. 21873/22358 of the proteins.
[0055] [0055] As used herein, the term "(amino acid/protein sequence)" in general refers to "variant sequences", i.e. proteins or (poly-)peptides comprising an amino acid sequence that differs by at least an amino acid residue of a reference (or "source") amino acid sequence of a reference (or "source") or (poly-)peptide protein.
[0056] [0056] "Variant" proteins/(poly-)peptides may thus preferably comprise, in their amino acid sequence, at least one amino acid mutation, substitution, insertion or deletion compared to their respective reference sequence. Substitutions can be selected from conservative or non-conservative substitutions. Protein/(poly-)peptide "variants" may comprise at least one conservative amino acid substitution, wherein amino acids originating from the same class are exchanged with each other. In particular, these are amino acids having aliphatic side chains, positively or negatively charged side chains, aromatic groups on the side chains, or amino acids, the side chains of which can form hydrogen bonds, e.g. side chains that have a hydroxyl function. By conservative constitution, for example, an amino acid having a polar side chain may be replaced by another amino acid having a corresponding polar side chain, or, for example, an amino acid characterized by a hydrophobic side chain may be replaced by another amino acid. - acid having a corresponding hydrophobic side chain (eg serine (threonine) to threonine (serine) or leucine (isoleucine) to isoleucine (leucine)). However, non-conservative amino acid substitutions are also envisaged herein.
[0057] [0057] Preferably, the term "variant" as used herein includes naturally occurring variants, e.g. pre-edition 870190141603, 12/30/2019, pg. 21874/22358 proteins, proproteins and proteins/(poly-)peptides that have undergone post-translational proteolytic processing (this may involve removal of the N-terminal methionine, signal peptide and/or conversion of an inactive protein or non-functional into an active or functional protein), and naturally occurring mutant proteins/(poly-)peptides. The term "variant" further encompasses modified protein/(poly-)peptide variants, which can be modified (by sequence) to introduce or abolish a particular biological property and/or functionality. The terms "transcriptional variants" or "splice variants" in the context of proteins/(poly-)peptides refer to variants produced from messenger RNAs that are initially transcribed from the same gene but are subsequently subjected to alternative (or differential) cutting and splicing, where particular exons of a gene can be included or excluded from the final processed messenger RNA (mRNA). It should be noted that the term "variant" can essentially be defined by a minimal degree of sequence identity (and preferably also a desired biological function/properties) compared to a reference protein/(poly-)peptides. Thus, fragments or certain derivatives (which also differ in terms of their amino acid sequence from the reference protein/(poly-)peptide) can also be classified as "variants". Therefore, a "variant" as defined herein may be derived from, isolated from, related to or based on the reference protein/(poly-)peptide or a fragment or derivative thereof.
[0058] [0058] The term "(amino acid/protein sequence) variant", as used herein, preferably refers to (poly-)peptides having a sequence identity of at least 5%, 10%, 20%, 30 %, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, forecast 870190141603, of 12/30/2019, p. 21875/22358 preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, with an amino acid sequence of the respective naturally occurring (wild-type) protein/(poly-)peptide, or a fragment or derivative thereof.
[0059] [0059] As used herein, the term "fragment of (amino acid/protein sequence)" in general refers to a protein/(poly-)peptide that consists of a continuous subsequence of the amino acid sequence of full length reference (or "source") protein/(poly-)peptide, which is, with respect to its amino acid sequence, N-terminal, C-terminal and/or intrasequentially truncated to comparison with the amino acid sequence of said protein/(poly-)peptide reference. This truncation can occur at the amino acid level or at the nucleic acid level, respectively. In other words, a "fragment" can typically be a shorter part of a full-length sequence of an amino acid sequence. Therefore, a fragment typically consists of a sequence that is identical to the corresponding stretch within the full-length amino acid sequence. The term includes naturally occurring fragments (such as fragments resulting from naturally occurring in vivo protease activity) as well as engineered fragments.
[0060] [0060] The term "fragment of (amino acid/protein sequence)" as used herein may refer to a protein/(poly-)peptide comprising an amino acid sequence of at least 5 contiguous amino acid residues, at least 10 contiguous amino acid residues, at least 15 contiguous amino acid residues, at least 20 contiguous amino acid residues, at least 25 contiguous amino acid residues, at least 40 re-edition 870190141603, 12/30/2019, page 21876/22358 contiguous amino acid residues, at least 50 contiguous amino acid residues, at least 60 contiguous amino acid residues, at least 70 contiguous amino acid residues, at least 80 contiguous amino acid residues, at least 90 contiguous amino acid residues at least 100 contiguous amino acid residues, at least 125 contiguous amino acid residues, at least 150 contiguous amino acid residues, at least 175 contiguous amino acid residues, at least 200 contiguous amino acid residues, or at least 250 contiguous amino acid residues contiguous amino acids of the amino acid sequence of a reference protein/(poly-)peptide, or a variant or derivative thereof.
[0061] [0061] A preferred fragment of a sequence in the context of the present invention consists of a continuous stretch of amino acids corresponding to a continuous stretch of entities in the reference protein/(poly-)peptide, which represents at least 20%, preferably at least 30%, more preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, even more preferably at least 70%, and most preferably at least 80% of that of the protein /(poly-)total (ie, full-length) reference peptide, or a variant or derivative thereof, from which the fragment is derived.
[0062] [0062] An indicated sequence identity with respect to such a fragment preferably refers to the entire amino acid sequence of the reference protein/(poly-)peptide. Preferably, a "fragment" may typically comprise or consist of an amino acid sequence having a sequence identity of at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least at least 70%, more preferably at least 80%, even more preferably at least 85%, still 'edition 870190141603, of 12/30/2019, p. 21877/22358 more preferably at least 90% and more preferably at least 95% or even 97%, with the amino acid sequence of a reference protein/(poly-)peptide, or a variant or derivative thereof.
[0063] [0063] As used herein, the term "derived (from amino acid/protein sequence)" should be understood generically as a protein/(poly-)peptide that has been modified with respect to a protein/( reference (or "source") poly-)peptide to include a new or additional property or functionality. Derivatives can be modified to comprise desired biological functionalities (e.g., by introducing or removing portions or domains that confer, enhance, reduce, or abolish enzymatic activities or target binding specificity or affinity), fabrication properties (e.g., by introducing moieties that confer high solubility or greater excretion, or allow for purification) or pharmacokinetic/pharmacodynamic properties for medical use (e.g., by introducing moieties that confer high stability, bioavailability, absorption; distribution and/or or reduced clearance). Derivatives can be prepared by introducing or removing a portion or domain that confers a functionality or biological property of interest. Such portions or domains can be introduced into the amino acid sequence (e.g., at the terminal amino and/or carboxyl residues) post-translationally or at the level of nucleic acid sequence level using standard genetic engineering techniques (cf. Sambrook J et al., 2012 (4th ed.), Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York). A "derivative" may be derived from (and thus optionally include) the naturally occurring (wild-type) protein/(poly-)peptide amino acid sequence, or a variant or fragment thereof.
[0064] [0064] It will be understood that "derivatives of (amino acid/protein sequence)" may differ (eg, may by means of introducing or removing portions of (poly-)peptide and/or protein domains) in their reference protein/(poly-)peptide amino acid sequence from which they are derived, and thus may also qualify the "variants". However, while "(amino acid/protein sequence) variants" are primarily defined in terms of their sequence identity to a reference amino acid sequence, derivatives are preferentially characterized by the presence or absence of a specific biological functionality or property compared to the reference protein. However, "derivatives of (amino acid/protein sequence)" may preferably comprise or consist of an amino acid sequence having a sequence identity of at least 5%, 10%, 20%, 30%, 40%, 50% , 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98 %, or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, with the amino acid sequence of a reference protein/(poly-)peptide, or a variant or fragment thereof.
[0065] [0065] According to preferred embodiments of the invention, the artificial nucleic acid molecule, preferably RNA, of the invention, encodes in its at least one coding region at least one additional amino acid sequence derived from any of the proteins indicated in Table 1 below, or a fragment, variant or derivative (preferably functional) of any of said proteins.
[0066] [0066] Preferably, in the context of the present invention, "functional" fragments, variants or derivatives have substantial edition 870190141603, of 12/30/2019, p. 21879/22358 have the same comparable biological functionality as their respective "source" or "reference" sequence. The definition is applicable to "functional" protein/peptide/amino acid sequence fragments, variants or derivatives, as well as "functional" nucleic acid/polynucleotide sequence fragments, variants or derivatives. The desired biological functionality is preferably indicated in the context of the respective sequence. In general, "functional" protein/peptide/amino acid sequence fragments may preferentially exhibit the same or comparable binding characteristics, targeting characteristics, immune response inducing characteristics, and so on as their "source" sequence. or "reference". The "functional" nucleic acid/polynucleotide sequence fragments, variants, or derivatives may preferably exhibit the same or comparable ability to decode and be expressed (i.e., optionally transcribed and translated) to produce a sequence of desired amino acid/peptide/protein as their respective "source" or "reference" sequence.
[0067] [0067] "Functional" IRSTepm protein fragments, variants and derivatives are preferentially capable of targeting antigenic proteins or peptides (preferably fused to them) to MHC class | and preferably MHC class II. Therefore, the use of "functional" IRSTepm protein fragments, variants and derivatives preferentially improves CD4+ T helper cell responses and, therefore, antibody-mediated and/or CD8+ CTL and/or elevated immunity. 'edition 870190141603, of 12/30/2019, page 21880/22358
[0068] [0068] According to preferred embodiments, the artificial nucleic acid molecule, preferably RNA, according to the invention, can encode in its at least one coding region at least one additional amino acid sequence derived from IRS- Tepm comprising or consisting of an amino acid sequence according to any one of SEQ ID NOs: 157-179, or a fragment, variant or derivative (preferably functional) of any one of said sequences, preferably comprising or consisting of a sequence amino acid having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80%, further more preferably at least 85%, even more preferably at least 90%, and most preferably at least 95% or even 97%, sequence identity to whichever any one of these sequences.
[0069] [0069] Therefore, the coding region of the artificial nucleic acid molecule, preferably RNA, according to the invention, may preferably comprise a nucleic acid sequence according to any one of SEQ ID NOs: 365-387, or a fragment, variant or derivative (preferably functional) of any of said sequences, preferably comprising or consisting of a nucleic acid sequence having, in increasing order of preference, at least 5%, 10%, 20%, 30 %, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even more 97% sequence identity with any of these sequences.
[0070] [0070] The term "(nucleic acid/polynucleotide/gene sequence) variant" refers to nucleic acid sequence variants, i.e. genes or nucleic acid sequences comprising a nucleic acid sequence that differs in at least one nucleic acid from a reference (or "source") nucleic acid sequence of a reference (or "source") gene or nucleic acid. Variant genes or nucleic acids may thus preferably comprise, in their nucleic acid sequence, at least one mutation, substitution, insertion or deletion as compared to their respective reference sequence. Preferably, the term "variant", as used herein, includes naturally occurring variants, and engineered variants of genes or nucleic acid sequences. Therefore, a "variant" as defined herein may be derived from, isolated from, related to, based on, or homologous to the reference nucleic acid sequence. "Variants" can preferably have a sequence identity of at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88 %, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and more preferably at least 95% or even 97%, with a nucleic acid sequence of the respective gene or naturally occurring nucleic acid sequence (wild-type ), or a homologue, fragment or derivative thereof.
[0071] [0071] The term "fragment of (nucleic acid/polynucleotide/gene sequence)" refers to a continuous subsequence of the full-length reference (or "source") gene or nucleic acid sequence. In other words, a "fragment" can typically be a shorter portion of a gene or nucleic acid sequence. 21886/22358 full-length clectic. Therefore, a fragment typically consists of a sequence that is identical to the corresponding extension within the gene or full-length nucleic acid sequence. The term includes naturally occurring fragments as well as engineered fragments. A preferred fragment of a sequence in the context of the present invention is a continuous stretch of nucleic acids corresponding to the continuous stretch of entities in the gene or nucleic acid from which the fragment is derived, which represents at least 20%, preferably at least 30%. %, more preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, even more preferably at least 70%, and most preferably at least 80% of the gene or nucleic acid sequence total (ie, total length) from which the fragment is derived. An indicated sequence identity with respect to such a fragment preferably refers to the entire gene or nucleic acid sequence. Preferably, a "fragment" may comprise a nucleic acid sequence having a sequence identity of at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, preferably at least 70 %, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, with a reference gene or nucleic acid sequence from which it is derived .
[0072] [0072] The term "derived from (nucleic acid/polynucleotide/gene sequence)" shall be understood generically as a nucleic acid/polynucleotide/gene sequence that has been modified with respect to a nucleic acid/polynucleotide/gene sequence reference (or "source") to include a property or feature 'edition 870190141603, 12/30/2019, pg. 21887/22358 new or additional purpose. Derivatives can be modified to comprise desired biological functionalities (eg, resistance to enzymatic degradation, translational effectiveness), manufacturing properties, or pharmacokinetic/pharmacodynamic properties for medical use (eg, by introducing moieties that confer high stability, bioavailability, absorption; reduced distribution and/or clearance). Derivatives can be prepared by introducing or removing a nucleic acid sequence or additional portion that confers a functionality or biological property of interest. Such a nucleic acid sequence or additional portions can be introduced using standard genetic engineering techniques (cf. Sambrook J et al., 2012 (4th ed.), Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York). A "derivative" may be derived from (and thus optionally include) the naturally occurring (wild-type) gene/polynucleotide/nucleic acid sequence or a variant or fragment thereof.
[0073] [0073] It will be understood that "derivatives of (gene/polynucleotide/nucleic acid sequence)" may differ (e.g., by introducing or removing (poly-)nucleotides) in their nucleotide sequence from the gene /polynucleotide/reference nucleic acid sequence from which they are derived, and thus may also be qualified as "variants". However, whereas "variants of (gene/polynucleotide/nucleic acid sequence)" are primarily defined in terms of their % sequence identity as a reference nucleotide sequence, "derivatives" are preferably characterized by the presence or absence of a specific biological functionality or property as compared to the reference gene/polynucleotide/nucleic acid sequence. However, "derivatives of (nucleic acid gene/polynucleotide/sequence 870190141603, 12/30/2019, pg. 21888/22358)" may preferably comprise or consist of an amino acid sequence having an identity of sequence of at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90% , 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90%, and more preferably at least 95% or even 97%, with the nucleic acid sequence of a reference gene/polynucleotide/nucleic acid sequence, or a variant or fragment thereof.
[0074] [0074] In the context of the present invention, "derivatives of (nucleic acid/polynucleotide sequence)" may particularly include nucleic acid/polynucleotide sequences that have been modified or stabilized as compared to the "source" nucleic acid sequences. or "reference" from which they are derived. It will be understood, however, that such modified/stabilized polynucleotides/nucleic acid sequences may also be defined as "variants".
[0075] [0075] A "functional" fragment, variant or derivative of said nucleic acid sequences preferably encodes (and thus allows for the expression of) an amino acid sequence derived from IRSTepm as defined herein.
[0076] [0076] According to preferred embodiments, the coding region of the artificial nucleic acid molecule, preferably RNA, according to the invention, may preferably comprise a nucleic acid sequence according to any one of SEQ ID NOs: 365 -387, 573-595, 781-803, 989-1011, 1197-1219, 1613-1635, 1821-1843, 2029-2051, 2237-2259, 2445-2467, 2653-2675, 2861-2883 or a fragment, variant or derivative (preferably functional) of any of said sequences, preferably com- 21889/22358 comprising or consisting of a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% , 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97% sequence identity to any such sequence.
[0077] [0077] It will be understood that the artificial nucleic acid molecule, preferably RNA, according to the invention may encode at least one or a plurality of at least two amino acid sequences derived from IRSTepm (identical or different) (cf. "Monocistronic, Bi- and Multicistronic RNAs").
[0078] [0078] In general, "identical" sequences (or molecules characterized by said sequences, such as nucleic acid molecules or (poly-)peptides) share 100% sequence identity, whereas " different" (or molecules characterized by said sequences, such as nucleic acid molecules or (poly-)peptides) share a sequence identity of less than 100%, such as 99% or less, 90% or less, 80 % or less, 70% or less, 60% or less, 50% or less, 40% or less, 30% or less, 20% or less, 10% or less, 5% or less, or 2% Or any less.
[0079] [0079] A particularly preferred IRSTepm protein may be CTLAA4. The additional amino acid sequence(s) encoded by at least one coding region of the artificial nucleic acid molecule, preferably RNA, of the invention may be derived from CTLAA.
[0080] [0080] Therefore, in preferred embodiments, the 'ethition molecule 870190141603, of 12/30/2019, p. 21890/22358 artificial nucleic acid, preferably RNA, of the invention may encode in its at least one coding region an additional CTLA4-derived amino acid sequence comprising or consisting of an amino acid sequence according to SEQ ID NO: 169, or a fragment, variant or derivative (preferably functional) thereof, preferably comprising or consisting of an amino acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40 %, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97% of sequence identity with SEQ ID NO: 169.
[0081] [0081] Preferably, the artificial nucleic acid molecule, preferably RNA, of the invention may thus comprise in its at least one coding region a nucleic acid sequence comprising or consisting of a nucleic acid sequence according to any one of SEQ ID Nos: 377, 585, 793, 1001, 1209, 1417, 1625, 1833, 2041, 2249, 2457, 2665 or 2873, or a fragment, variant or derivative (preferably functional) of any of said sequences, preferably comprising or consisting of a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85 %, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, preferably at least 70% , more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97% sequence identity with any of said sequences.
[0082] [0082] According to preferred embodiments, the at least one additional amino acid sequence derived from IRSTepm encoded in the at least one coding region of the artificial nucleic acid molecule, preferably RNA, according to the invention, may comprise or consist of a transmembrane domain derived from IRSTepm. Therefore, in the artificial nucleic acid molecule, preferably RNA, of the invention, said at least one additional IRSTepm-derived Amino Acid Sequence may preferably comprise or consist of b. at least one transmembrane domain.
[0083] [0083] "Transmembrane domains" are typically short (less than 50 amino acids) helical or beta-stranded domain protein domains that span membranes. The transmembrane domains can be determined experimentally, for example by X-ray diffraction, or they can be predicted based on sequence similarities or using known prediction tools such as MHMM, Memsat, Phobius and the plotting method. of the hydrophobic moment. Without wishing to be bound by a specific theory, it is predicted that transmembrane domains derived from "fast recycling" IRSTepm are advantageously capable of anchoring fused antigenic peptides or proteins to the plasma membrane, where they are recycled or guided to cell compartments. of MHC processing | and, in particular, MHC II.
[0084] [0084] According to preferred embodiments of the invention, the artificial nucleic acid molecule, preferably RNA, of the invention, encodes in its at least one coding region at least one transmembrane domain as indicated in Table 2 below, or a fragment , variant or derivative (preferably functional) of any of said transmembrane domains.
[0085] [0085] According to preferred embodiments, the artificial nucleic acid molecule, according to the invention, can encode in its at least one coding region at least one transmembrane domain derived from IRSTepm comprising or consisting of a sequence of an amino acid according to any one of SEQ ID NOs: 180-208, or a fragment, variant or derivative (preferably functional) of any one of said sequences, preferably comprising or consisting of an amino acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90 %, 91%, 92%, 93%, 294%, 95%, 96%, 97%, 98%, or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85% , even more preferably at least 90% and most preferably at least 95% or even 97% sequence identity to any such sequence.
[0086] [0086] Therefore, the artificial nucleic acid molecule, preferably RNA, of the invention may preferably comprise in its at least one coding region a nucleic acid sequence according to any one of SEQ ID NOs: 388- or a fragment, variant or derivative (preferably functional) of any of said sequences, preferably comprising or consisting of a nucleic acid sequence having, in increasing order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95% , 96%, 97%, 98%, or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably. 2019, pg. 21899/22358 at least 90% and more preferably at least 95% or even 97% sequence identity to any such sequence.
[0087] [0087] More preferably, the artificial nucleic acid molecule, preferably RNA, of the invention may encode in its at least one coding region a CTLA4-derived transmembrane domain comprising or consisting of an amino acid sequence according to the SEQ ID NO: 200, or a fragment, variant or derivative (preferably functional) thereof, preferably comprising or consisting of an amino acid sequence having, in increasing order of preference, at least 5%, 10% , 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94 %, 95%, 96%, 97%, 98%, or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and more preferably at least 95% or even 97% sequence identity to SEQ ID NO:
[0088] [0088] Preferably, the artificial nucleic acid molecule, preferably RNA, of the invention may thus comprise in its at least one coding region a nucleic acid sequence comprising or consisting of a nucleic acid sequence according to any one of the SEQ ID NOs: 408, 616, 824, 1032, 1240, 1448, 1656, 1864, 2072, 2280, 2488, 2696 or 2904, or a fragment, variant or derivative (preferably functional) of any of said sequences, preferably with - comprising or consisting of a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85 %, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, preferred-'edition 870190141603 , of 12/30/2019, p. 21900/22358 at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97% sequence identity to any one of the aforementioned sequences. Cytoplasmic Domain (CD)
[0089] [0089] According to preferred embodiments, the at least one additional amino acid sequence derived from IRSTepm encoded in the at least one coding region of the artificial nucleic acid molecule, preferably RNA, according to the invention, may optionally (additionally ) comprise or consist of a cytoplasmic domain derived from IRSTepm. Therefore, in the artificial nucleic acid molecule, preferably RNA, of the invention, said at least one additional IRS-Tepm-derived amino acid sequence may preferably (additionally) comprise or consist of c. at least one cytoplasmic domain.
[0090] [0090] "Cytoplasmic domains" are intracellular domains that typically interact with the interior of the cell. Without wishing to be bound by a specific theory, it is envisioned that cytoplasmic domains derived from IRSTepm may still confer advantageous targeting characteristics to peptides or antigenic proteins encoded for MHC Processing Compartments | and, in particular, MHC |.
[0091] [0091] Preferably, the cytoplasmic domain derived from IRSTepm may be present in addition to the transmembrane domain derived from IRSTepm. The cytoplasmic domain and the transmembrane domain can be derived from identical or different IRSTepm proteins. In accordance with some preferred embodiments, the cytoplasmic domain and the transmembrane domain are present in a continuous additional IRSTepm-derived amino acid sequence.
[0092] [0092] According to preferred embodiments, the at least one additional amino acid sequence derived from IRSTepm encoded in the at least one coding region of the artificial nucleic acid molecule, preferably RNA, according to the invention, may comprise or consist of a transmembrane domain derived from IRSTepm AND a cytoplasmic domain derived from IRSTepm. Therefore, in the artificial nucleic acid molecule, preferably RNA, of the invention, said at least one amino acid sequence derived from IRSTepm may preferably comprise or consist of b. at least one transmembrane domain and c. at least one cytoplasmic domain.
[0093] [0093] According to preferred embodiments, the artificial nucleic acid molecule, according to the invention, can encode in its at least one coding region at least one transmembrane domain derived from IRSTepm AND at least one cytoplasmic domain - optical comprising or consisting of an amino acid sequence according to any one of SEQ ID NOs: 76625 - 76647, or a fragment, variant or derivative (preferably functional) of any one of said sequences, preferably comprising or consisting of in an amino acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87% , 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, preferably at least 70%, more preferably at least 80% , even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97% sequence identity cia with any of these sequences.
[0094] [0094] Therefore, the artificial nucleic acid molecule, preferably RNA, of the invention may preferably comprise in its at least one coding region a nucleic acid sequence according to any one of SEQ ID NOs: 76648 - 76694 - 76716, 76671 - 76693, 77004 - 770017, 76763 - 76785, 76786 - 76808, 76809 - 76831, 76832 - 76854, 76855 - 76877, 76878 - 76877, 76878 - 76877, 76901 - 76923, 76924 - 76946, 76947, 76740 — 76762, 77066, or a fragment, variant or derivative (preferably functional) of any of said sequences, preferably comprising or consisting of a nucleic acid sequence having, in increasing order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92% 12/30/2019, pg. 21906/22358 at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97% sequence identity to any such sequence.
[0095] [0095] More preferably, the artificial nucleic acid molecule, preferably RNA, of the invention may encode in its at least one coding region a CTLA4-derived transmembrane domain and cytoplasmic domain comprising or consisting of a sequence of amino acid according to SEQ ID NO: 76636, or a fragment, variant or (preferably functional) derivative thereof, preferably comprising or consisting of an amino acid sequence having, in increasing order of preference, at least 5% , 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93 %, 94%, 95%, 96%, 97%, 98%, or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and more preferably at least 95% or even 97% sequence identity to SEQ ID NO: 76636.
[0096] [0096] Preferably, the artificial nucleic acid molecule, preferably RNA, of the invention may thus comprise in its at least one coding region a nucleic acid sequence comprising or consisting of a nucleic acid sequence according to any one of the following: SEQ ID NOs: 76659, 76705, 76728, 76682, 77004-77017, 76774, 76797, 76820, 76843, 76866, 76912, 76889, 76935, 76947, 76751, 77066 or a fragmentary (preferred) variant or functional derivative one of said sequences, preferably comprising or consisting of a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 'edition 870190141603 , of 12/30/2019, p. 21907/22358
[0097] [0097] The nucleic acid sequence of the RNA of the invention can be adapted so as to allow the differentiation of different RNA species in a composition comprising more than one RNA species. Preferably, the nucleic acid sequence of the RNA is adapted without introducing changes to the amino acid sequence encoded by the respective RNA. Preferably, the RNA nucleic acid sequence is adapted over a span of 10-200 nucleotides to allow differentiation of different RNA species through PCR-based analytical methods. The adapted sequence extension(s) may be positioned in an untranslated region (UTR), in the coding sequence of a signal peptide, in the epitope coding sequence, in a linker region, in the coding sequence of a helper epitope, in the transmembrane region of CTLAA, in the cytoplasmic region of CTLAA4, in the transmembrane and cytoplasmic region of CTLAA4. Preferably, adapted sequence extensions allowing the differentiation of different RNA species in a composition are introduced into the transmembrane and cytoplasmic region of CTLA4. As a non-limiting example, a composition comprising two different RNA species, where the adapted sequence extensions allowing differentiation are in the transmembrane and cytoplasmic region of CTLAA4 (e.g. SEQ ID NO: 77004 and SEQ ID NO : 77005). As yet another non-limiting example, a composition comprising three different RNA species, in which the selec- tion extensions 870190141603, dated 12/30/2019, p. 21908/22358 adapted sequences allowing differentiation are in the transmembrane and cytoplasmic region of CTLA4 (e.g. SEQ ID NO: 77004, SEQ ID NO: 77005 and SEQ ID NO: 77006). As another non-limiting example, a composition comprising thirteen different RNA species, in which the adapted sequence extensions allowing differentiation are in the transmembrane and cytoplasmic region of CTLAA4 (e.g. SEQ ID NO: 77004 - SEQ ID NO: 77017). Antigenic peptide or protein (AN)
[0098] [0098] The artificial nucleic acid molecule, preferably RNA, according to the invention, encodes, in its at least one coding region, a. at least one antigenic peptide or protein. In accordance with preferred embodiments, the nucleic acid sequence encoding said at least one antigenic peptide or protein may be fused (in frame) to a nucleic acid sequence encoding at least one amino acid sequence derived from IRTepm. Therefore, expression of the artificial nucleic acid molecule, preferably RNA, of the invention may preferably result in a fusion protein comprising at least one antigenic peptide or protein linked to (optionally via suitable ligands) at least one sequence. of additional amino acid derived from IRSTepm. Said additional amino acid sequence preferentially directs the antigenic peptide or protein to MHC class | and, more preferably, MHC class |1, resulting in better presentation of MHC class | and/or, preferably, MHC class II.
[0099] [0099] In general, the present invention provides for the combination of any of the antigenic peptides or proteins described herein with any of the additional amino acid sequences derived from IRSTepm-, any of the ligands, and any of the signal peptides described in this document, in any order 'edition 870190141603, dated 12/30/2019, p. 21909/22358 in the antigenic fusion proteins encoded by the artificial nucleic acid molecules, preferably RNAs, of the invention.
[00100] [00100] The term "antigenic peptide or protein" generally refers to any peptide or protein capable, under appropriate conditions, of interacting with/be recognized by components of the immune system (such as antibodies or immune cells). The "antigenic peptide or protein" preferentially interacts with/is recognized by components of the immune system through its "epitopes(s)" or "antigenic determinants". Thus, the term "antigenic peptide or protein" refers to a (poly-)peptide comprising, consisting of or being capable of providing at least one (functional) epitope. It is particularly envisaged that the artificial nucleic acid molecules, preferably RNAs, of the invention encode full-length antigenic peptides or proteins, or preferably fragments thereof. Said fragment may comprise or consist of (functional) epitopes of said antigenic peptides or proteins. Preferably, said fragments or epitopes are expressed in the host cell, targeted to MHC class | and, preferably, MHC class II, and recognized by components of the immune system.
[00101] [00101] The term "components of the immune system" preferably refers to immune cells, immune cell receptors and antibodies of the adaptive immune system. "Antigenic peptides or proteins" are preferentially capable of being processed by the intracellular mechanism to be presented to immune cells in an MHC molecule, preferentially resulting in an antigen-specific immune response (e.g., cell-mediated immunity). or antibody formation). "Antigenic peptides or proteins" can be the translation product of a nucleic acid molecule arti- tion 870190141603, dated 12/30/2019, p. 21910/22358, preferably RNA, of the invention.
[00102] [00102] The term "epitope" or "antigenic determinant" refers to a part or fragment of an antigenic peptide or protein that is recognized by the immune system. Said fragment may typically comprise from about 5 to about 20 or even more amino acids. The epitopes can be "conformational" (or "discontinuous"), that is, composed of discontinuous sequences of the amino acids of the antigenic peptide or protein from which they are derived, but assembled into the three-dimensional structure of, for example, an MHC complex, or "line - ares", that is, they consist of a continuous sequence of amino acids of the antigenic peptides or proteins from which they are derived. The term "epitope" broadly encompasses "T cell epitopes" (recognized by T cells through their T cell receptor) and "B cell epitopes" (recognized by B cells through their of its B cell receptor). "B cell epitopes" are typically located on the outer surface of (native) peptide or protein antigens, as defined herein, and may preferably comprise or consist of 5 to 15 amino acids, more preferably, between 5 to 12 amino acids, even more preferably between 6 to 9 amino acids. "T cell epitopes" are typically recognized by T cells in an MHC-I or MHC-II bound form, i.e., as a complex formed by an antigenic peptide or protein fragment comprising the epitope, and a molecule surface of MHC-I or MHC-II. "T cell epitopes" can typically be from about 6 to about 20 or even more amino acids in length, T cell epitopes presented by MHC class | they may preferably be from about 8 to about 10 amino acids in length, for example 8, 9 or 10 (or even 11 or 12 amino acids). T cell epitopes presented by MHC class II molecules can preferably be about 'edition 870190141603, 12/30/2019, pg. 21911/22358 of 13 or more amino acids, for example 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or even more amino acids. In the context of the present invention, the term "epitope" may in particular refer to T cell epitopes.
[00103] [00103] When referring to an artificial nucleic acid molecule, preferably RNA, encoding "at least one antigenic peptide or protein" in this document, it is envisaged that said artificial nucleic acid molecule may encode one or more peptide(s) ) or full-length antigenic protein(s) (wild-type/variant/derived), or one or more fragments, in particular a (functional) epitope, of said peptide or antigenic protein (wild-type/variant /derivative). Said full-length (wild-type/variant/derived) peptide(s) or antigenic protein(s), or fragment(s) thereof, preferably comprises , consists of or provides at least one (functional) epitope, i.e. said antigenic peptide(s) or antigenic protein(s) (wild-type/variant/derived) or its Fragment(s) preferably comprises or consists of a native epitope (preferably recognized by B cells) or is capable of being processed and presented by an MHC-I or MHC-II molecule to provide an MHC-linked epitope ( preferentially recognized by T cells). A "functional" epitope refers to an epitope capable of inducing a desired adaptive immune response in an individual.
[00104] [00104] The at least one antigenic peptide or protein encoded by the artificial nucleic acid molecule, preferably RNA, of the invention may be N-terminal, C-terminal or intrasequentially fused to or composed of at least one amino acid sequence derived from IRSTepm , optionally via appropriate peptide linkers (providing an "antigenic fusion protein" as defined herein). In this way, it is foreseen, among other things, 'edition 870190141603, of 12/30/2019, p. 21912/22358 herein, that the artificial nucleic acid molecule, preferably RNA, of the invention encodes an amino acid sequence derived from IRSTepm, as defined herein, that comprises an antigenic peptide or protein, or produces a functional epitope. - nal, as defined in this document.
[00105] [00105] The choice of appropriate antigenic peptides or proteins generally depends on the condition or disease to be treated or prevented. In general, the artificial nucleic acid molecule, preferably RNA, can encode any antigenic peptide or protein (or any desired combination of antigenic peptides or proteins) in its at least one coding region. It is also contemplated herein to provide artificial nucleic acid molecules, preferably RNAs, encoding a plurality of any combination of at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more antigenic peptides or proteins ( identical or different), preferably as defined herein (see, for example, polyvalent vaccines).
[00106] [00106] Preferred antigenic peptides and proteins are specified below. Antigenic Peptides or Proteins Derived from Tumor Antigens
[00107] [00107] According to preferred embodiments, the artificial nucleic acid molecule, preferably RNA, according to the invention, encodes, in its at least one coding region, at least one antigenic peptide or protein derived from it. of a tumor antigen.
[00108] [00108] The term "tumor antigen" refers to antigens derived from or associated with a tumor or cancer (preferably malignant) disease. As used in this document, the terms "cancer" and "tumor" are used interchangeably to refer to a publication 870190141603, 12/30/2019, pg. 21913/22358 oplasia characterized by uncontrolled and often rapid proliferation of cells that tend to invade surrounding tissue and metastasize to distant sites in the body. The term encompasses both benign and malignant neoplasms. Malignancy in cancers is typically characterized by anaplasia, invasiveness, and metastasis; while benign malignancies typically have none of these properties. The terms "cancer" and "tumor", in particular, refer to neoplasms characterized by tumor growth, but also to cancers of the blood and lymphatic system. A "tumor antigen" is typically derived from a tumor/cancer cell, preferably a mammalian tumor/cancer cell, and may be located on or on the surface of a tumor cell derived from a mammalian tumor, preferably a human. , such as a systemic or solid tumor. "Tumor antigens" generally include tumor-specific antigens (TSAs) and tumor-associated antigens (TAAs). TSAs can be presented only by tumor cells and not by normal "healthy" cells. They typically result from a tumor-specific mutation. TAAs, which are more common, are usually presented by tumor and healthy cells. These antigens are recognized and the antigen-presenting cell can be destroyed by cytotoxic T cells. In addition, tumor antigens can also occur on the surface of the tumor in the form of, for example, a mutated receptor. In that case, they can be recognized by antibodies.
[00109] [00109] Preferably, the at least one antigenic peptide or protein encoded by at least one coding region of the artificial nucleic acid molecule, preferably RNA, of the invention can be derived from the melanoma antigen recognized by T cells 1, eukaryotic translation initiation factor 4 gamma 1, Histone H1.2, cyclin-dependent kinase 4, 40S S21 ribosomal protein, etiology factor 870190141603, dated 12/30/2019, pg. 21914/22358 DNA replication licensing MCMA, Actin, gamma-enteric smooth muscle, melanocyte protein PMEL, phospholipid transfer protein, Vimentin, eukaryotic translation initiation factor D subunit 3, associated antigen 1 melanoma, fructose-bisphosphate aldolase A, guanine nucleotide-binding protein G(1)/G(S)/G(T) beta-2 subunit, ER membrane protein complex subunit 7, cytoplasmic actin 1, protein high mobility group B1, protein 2 containing the spiral-coil-helix-coil-coil-helix domain, HLA class II histocompatibility antigen, DP beta 1 chain, 60S L13 ribosomal protein, thymosin beta-10, short isoforms of guanine nucleotide-binding protein G(s) alpha subunit, beta-2-like guanine nucleotide-binding protein subunit 1, Bax 1 inhibitor, Wilms tumor protein, C-terminal gamma-secretase fragment 59, thymidylate synthase, ribosomal protein 60S L10, gave Lys-63-specific biquitinase BRCC36, myelin basic protein, HLA class I histocompatibility antigen, A-2 alpha chain, LAMTORS regulatory complex protein, 40S S25 ribosomal protein, F member of the POTE ankyrin domain family, Mortality factor 4-like protein 1, Melanoma associated antigen 3, Heme oxygenase 1, G2/mitosis-specific cyclin-B1, proteasome alpha subunit type 5, THEMIS 2 protein, fatty acid synthase, mammaglobin -A, Actin-related protein 2, 60S L28 ribosomal protein, 60S PO acid ribosomal protein, p53 cell tumor antigen, type 3 beta proteasome subunit, DNA (cytosine-5) methyltransferase 1, beta-1 catenin , myosin-9, reticulobin-2, heterogeneous nuclear ribonucleoprotein A1, ribosomal protein 60S L8, nucleoside diphosphate reductase subunit M2, Melanoma-associated antigen B2, SSX2 protein, proliferative cell nuclear antigen, receptor tyrosine kines protein and erbB-2, heat shock protein HSP 90-beta, ornithine 'etition 870190141603, 12/30/2019, pg. 21915/22358 decarboxylase, ubiquitin-conjugating enzyme E2 E3, ribosomal protein 608 L19, small nuclear ribonucleoprotein-associated proteins B and B', elongation factor 2, putative small nuclear ribonucleoprotein G-like protein 15, serine-tRNA ligase, beta -2-cytoplasmic microglobulin, ADP/ATP 2 translocase, Acyl-CoA desaturase, ubiquitin-60S L40 ribosomal protein, Prelamin-A/C, 71 kDa cognate heat shock protein, melanoma-associated antigen 2 , beta-adrenergic receptor kinase 1, Farnesyl pyrophosphate synthase, 40S S8 ribosomal protein, glutamate carboxypeptidase 2, serine/threonine protein catalytic subunit PP1-beta phosphatase, ATP-binding cassette F subfamily member 2, thiol reductase interferon gamma-inducible lysosomal, Stress-70 protein, mitochondrial, Mucin-1, Rac GTPase 1 activator protein, HLA class γ histocompatibility antigen, alpha chain B-39, 40S S16 ribosomal protein, ti rosinase, HLA class 1 histocompatibility antigen, alpha E chain, bifunctional purine biosynthesis protein PURH, transferrin receptor protein 1, ELAV-like protein 1, small nuclear ribonucleoprotein A U1, heat shock 1-like protein 70 kDa, HLA class II histocompatibility antigen, alpha chain DR, alpha subunit of T complex protein 1, cell adhesion molecule related to carcinoembryonic antigen 5, Histone H2AX, Lamina-B1, 60S P2 acid ribosomal protein , Actin, cytoplasmic 2, B lymphocyte antigen CD20, Actin, aortic smooth muscle, likely global transcriptional activator SNF2L2, myotubularin-related protein 5, beta proteasome subunit type 1, ribosomal protein 608 L7a, Histone H3.3, protein ribosomes - soma 608 L24, ribosomal protein 408 S3, sw HLA class | histocompatibility antigen, Cw-7 alpha chain, HLA class | histocompatibility antigen, B-15 alpha chain, serine/treo protein nin kinase Sgk1i, PPi-alpha catalytic subunit of seri-etition protein 870190141603, 12/30/2019, p. 21916/22358 na/threonine phosphatase, heterogeneous nuclear ribonucleoprotein K, L-dopachrome tautomerase, flightless protein homologue 1, dual specificity protein phosphatase 5, TSC22 domain family protein 3, cancer/testis antigen 1, isoform serine/threonine phosphatase 2A protein 65 kDa regulatory subunit alpha, Sec23B protein transporter protein, Sec23A protein transporter protein, CD59 glycoprotein, alpha-5 collagen chain (IV), protein 3A containing rich interactive domain AT, polypyrimidine tract-binding protein 1, spermine synthase, glutamine-fructose-6-phosphate aminotransferase [isomerization] 1, eukaryotic translation initiation factor L subunit 3, BTG2 protein, RNA polymerase subunit RPB1 | DNA-targeted, myeloblastin, HLA class I histocompatibility antigen, Cw-3 alpha chain, Importin alpha-5 subunit, fibrillarin 2'-O-methyltransferase rRNA, cyclin-A2, DNA-dependent RNA helicate DDX5 Probable ATP, cytochrome c oxidase subunit 2, IST1 homolog, 60S L35 ribosomal protein, triosephosphate isomerase, classification nexin-5, melanoma-associated antigen 4, Ubiquilin-4, HLA histocompatibility antigen class |, Cw- 2 alpha, interferon-induced transmembrane protein 1, amyloid beta protein A4, 70 kDa heat shock protein 1B, HLA class | histocompatibility antigen, alpha chain A-1, G antigen 12H, transaldolase, DHX16-dependent RNA helicase ATP from putative pre-mRNA splicing factor, protein 14-3-3 gamma, serine/threonine protein kinase SMG1, cyclin-L1, glyceraldehyde-3-phosphate dehydrogenase, fatty acid chain protein 1 elongation very long, member 2 of the RP/EB family of proteins in microtubule-associated, epsilon subunit of T-complex protein 1, sphingolipid delta (4)-desaturase DES1, elongation of very long-chain fatty acid protein 5, ORM1-like protein 2, IAP repeat-containing protein 7 baculoviral, protein 870190141603, of 12/30/2019, p. 21917/22358 in ubiquitin ligase ES TRIM68, putative endogenous sequence related to HTLV-1, myelin proteolipid protein, protein 1 containing SAM and SH3 domain, ubiquitin protein ligase E3 SIAH1, muscleblind-like protein 2, annexin A1, ubiquitous nuclear casein and cyclin-dependent kinase substrate 1, pleiotropic regulator 1, subunit 3 of the alpha subcomplex of NADH dehydrogenase [ubiquinone] 1, CD99 antigen, alpha subunit of G(o) binding protein guanine nucleotide, Calsintenin-1, transamidase component GPI PIG-T, Perilipin-3, WDAJ0 repeat-containing SMU1 protein, S100-B protein, annexin A11, histone H2B type 2-F, Calmodulin, protein 1 of interaction with phosphoinositide-3-kinase, subunit 4 of the THO complex, AHNAK protein associated with neuroblast differentiation, Phosphoserine aminotransferase, Histone deacetylase 7, Gelsolin, Tight junction protein ZO-1, sulfur-iron protein 7 of NADH dehydrogenase [ubiquinone ] , mitochondrial, LIM domain LMO4 transcription factor, spectrin beta chain, non-erythrocytic 1, C2 subunit of NADH dehydrogenase [ubiquinone] 1, testican-2, alpha-adducin, F subunit of proton ATPase type V, ribosomal 408 SA protein, Bcl-2-associated transcription factor 1, ATP-synthase coupling factor 6, mitochondrial, phosphatidylethanolamine binding protein 1, 40S S29 ribosomal protein, Septin-2, Methyl-binding domain protein 3 -CpG, transcription/transformation domain-associated protein, transcription factor HES-1, Paralemin-2, sodium/potassium transporter ATPase alpha-3 subunit, Statmin, L-type heterogeneous nuclear ribonucleoprotein, nodal modulator 3 , interferon-induced GTP-binding protein Mx2, neuronal membrane glycoprotein M6-b, Contactin-1, cytosolic non-specific dipeptidase, Noelin-2, serine/threonine protein kinase DCLK1, small nuclear ribonucleoprotein B U2, protein autoant sperm nuclear igenic, ribosomal protein 605 L5, promotion 870190141603, of 12/30/2019, p. 21918/22358 Endoplasmic reticulum-Golgi intermediate compartment protein 1, programmed cell death protein 4, Endoplasmin, eukaryotic translation initiation factor E3 F subunit, Cofilin-1, PKM pyruvate kinase, subunit of Dolichil-diphosphooligosaccharide protein glycosyltransferase STT3A, 5'(3')-deoxyribonucleotidase, cytosolic type, CKLF-like MARVEL transmembrane domain-containing protein 6, subunit 1 of the polyadenylation and cleavage specificity factor, protein transporter neutral amino acids B(0), PRRC1 protein, probable ATP-dependent RNA helicase DDXA49, nuclear pore complex protein Nup160, ATP synthase beta subunit, mitochondrial, signal-peptidase complex subunit 2, iota-like protein kinase C, Histone acetyltransferase p300, Histone H2A type 1-A, small nuclear ribonucleoprotein G, nucleosome assembly protein 1-like 1, ribosomal protein 40S S11, structural maintenance of chromosomes 3, Centrin-2, GTP-binding nuclear protein Ran, 40S S3a ribosomal protein, ATP-dependent RNA helicate A, eta subunit of T-complex protein 1, ECM29 proteasome-related protein homolog, GPN-cycle GTPase 1, 60S L10a ribosomal protein, C1/C2 heterogeneous nuclear ribonucleoproteins, Hydroxymethylglutaryl-CoA synthase, cytoplasmic, Sterol O-acyltransferase 1, Tuberin, Eukaryotic Translation Elongation Factor 1 epsilon-1, Regu Subunit - phosphoinositin 3-kinase binder, Annexin A2, small nuclear ribonucleoprotein U2 A', serine/threonine protein kinase SIK1, Nucleolin, L-lactate dehydrogenase B chain, L-lactate dehydrogenase A chain, aladin, associated protein 4 a microtubule, Peroxiredoxin-5, mitochondrial, HLA class | histocompatibility antigen, alpha chain B-7, carbamoyl phosphate synthase [ammonia], mitochondrial, protein 12 containing coiled coil domain, kinectin, keratin, cytoskeletontype | 18, ribosomal protein 408 S5, 870190141603 870190141603, 12/30/2019, pg. 21919/22358 nucleosome gem, U4/U6 small nuclear ribonucleoprotein Prp31, ELAV-like protein 3, HA-1 minor histocompatibility protein, low-affinity immunoglobulin Fc epsilon receptor, proteasome non-ATPase regulatory subunit 2 2698 , ATP-dependent RNA helicase DDX3X, putative homeodomain transcription factor 2, Transcription factor BTF3, ribosome biogenesis protein BRX1 homologue, HLA histocompatibility antigen class |, B-8 alpha chain, dynamin- 2, ELAV-like protein 4, ATP-dependent RNA helicase DDX3Y, histone demethylase UTY, pumilium homolog 3, histone H4, Histone H3.2, Protein S100-A9, macrophage migration inhibitory factor, alpha subunit of hemoglobin, 40S S17 ribosomal protein, collagen alpha-1(1) chain, collagen alpha-2(1) chain, T-complex protein 1 theta subunit, Culin-1, DNA replication licensing factor MCM7, BolA-like protein 2, topoisom DNA 2-beta erase, type 4 alpha proteasome subunit, bifunctional glutamate/proline-tRNA ligase, sodium/potassium transport ATPase alpha-1 subunit, MIC60 subunit of the MICOS complex, Peptidyl-prolyl-cis-trans isomerase A, subunit 7 of the beta 1 subcomplex of NADH dehydrogenase [ubiquinone], zinc finger MYM type protein 2, RhoA transforming protein, putative endoplasmin-like protein, plasminogen activator inhibitor RNA binding protein 1, Uncharacterized protein C200rf24, importin beta-1 subunit, melanoma-associated D2 antigen, Spindly protein, epsilon coatomer subunit, Xklp2 targeting protein, subunit 4 of the ribonucleoprotein H/ACA complex, subunit 3 of the ribonucleoprotein complex H/ACA, protein 2 related to cerebellar degeneration, component of the exocyst complex 2, 1-phosphatidylinositol 3-phosphate 5-kinase, subunit 3 of the proteasome activating complex, protein of the p complex nuclear oros 'edition 870190141603, of 12/30/2019, p. 21920/22358
[00110] [00110] According to preferred embodiments, the at least one antigenic peptide or protein encoded by at least one coding region of the artificial nucleic acid molecule, preferably RNA, of the invention may be derived from a mutated tumor antigen selected from ZFHX3 (R1893G), XPO1 (E571K), VHL (S111N; S65*; S68*), VHL (L89H), UBR5 (E2121K), U2AF1 (S34F), TSC 2 (splice variant), TRRAP (S722F), TP53 (A159P; A159V; AI161T; C135F; C135Y; C141Y; C176F; C176Y; C229Y; C238F; C238Y; C242A; C242F; C275F; C275Y; C277F; D259Y; D281N; D281Y; E194*; ; E271K; E285*; E285K; E286K; E294*; E298*; E56*; F134L; G154A; G244C; G244D; G2448; G245C; G245D; G245S; G245V; G262V; G266*; G266E; G266R; H G276V; H179R; H179Y; H193L; H193P; H193R; H193R; H214R; 1195T; 1255F; K132E; K132N; K132R; L130F; L194R; M237I; N239 *; P151S; P152L, p277R; p278A; p278A; ; P278S; P27L; Q104*; Q136*; Q144*; Q167*; 0192*; 0317*; 0331*; R110L; R156P; R158G; R158H; R158L; R175G; R175H; R196*; R196P; R213*; R213Q; R248Q; R248W; R249G; R249M; R249S; R249W; R267P; R273C; R273H; R273L; R273P; R280G; 'edition 870190141603, of 12/30/2019, page 22061/22358
[00111] [00111] According to preferred embodiments, the artificial nucleic acid molecule according to the invention may encode in its at least one coding region at least one antigenic peptide or protein comprising or consisting of an amino acid sequence of according to any one of SEQ ID NOs: 3719 - 27945; 76420 - 76439, 76440 - 76474 or a fragment, variant or derivative of any of said sequences, preferably comprising or consisting of an amino acid sequence having, in increasing order of preference, at least 5%, 10%, 20%, 30 %, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97% sequence identity with any of these sequences.
[00112] [00112] According to preferred embodiments, the artificial nucleic acid molecule according to the invention may encode in its at least one coding region at least one antigenic peptide or protein comprising or consisting of an amino acid sequence according to SEQ ID NOs: 1 - 504 in patent application WO2017182634 (as listed in Table 1) or a fragment, variant or derivative of any of said sequences, preferably comprising or consisting of an amino acid sequence having, in ascending order preferably at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 294%, 95%, 96%, 97%, 98%, or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, still 'edition 870190141603, of 12/30/2019, page 22064/22358 more preferably at least 90% and most preferably at least 95% or even 97% sequence identity to any such sequence.
[00113] [00113] Therefore, the artificial nucleic acid molecule coding region according to the invention may preferably comprise a nucleic acid sequence according to any one of SEQ ID NOs: 27946 - 52172; 76495 - 76514, 52173 - 76399; 76570 — 76589, 76515 — 76549, 76590 - 76624 or a fragment, variant or derivative of any of said sequences, preferably comprising or consisting of a nucleic acid sequence having, in increasing order of preference, at least minus 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92 %, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and more preferably at least 95% or even 97% sequence identity to any such sequence.
[00114] [00114] According to preferred embodiments, the artificial nucleic acid molecule according to the invention may comprise in its at least one coding region at least one nucleic acid sequence according to SEQ ID NOs. : 505 - 4536 in patent application WO2017182634 (as listed in Table 1) or a fragment, variant or derivative of any of said sequences, preferably comprising or consisting of a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 80% 870190141603, of 12/30/2019, page 22065/22358 at 85%, even more preferably at least 90% and most preferably at least 95% or even 97% sequence identity to any such sequence.
[00115] [00115] According to particularly preferred embodiments, the artificial nucleic acid molecule, preferably RNA, of the invention may encode in its at least one coding region an antigenic peptide or protein derived from a selected BRAF tumor antigen. , PIK3CA, KRAS, IDH1, TP53, NRAS, AKTI, SF3B1, CDKN2A, RPSAP58, EGFR, NY-ESO1, MUC-1, 5T4, Her2, MAGE-A3, LY6K, CEACAM6, CEA, MCAK, KK-LC1, Gastrin , VEGFR2, MMP-7, MFOSF1, MAGE-A4, MAGE-A1, MAGE-C1, PRAME, Survivin, MAGE-A9, MAGE-C2, FGFR2, WT1, PSA, PSMA, antigen-specific precursor prostate, Kita-kyushu lung cancer antigen 1, trophoblast glycoprotein, cyclin-dependent kinase inhibitor 2A, cyclin-dependent kinase inhibitor 2A, isoforms 1/2/3, cyclin-dependent kinase 4 inhibitor p16 /multiple tumor suppressor 1, GTPase NRas, or a fragment, variant or derivative of any of said tumor antigens, or any combination thereof. Bacterial, viral, protozoan and fungal antigens
[00116] [00116] According to other preferred embodiments, the artificial nucleic acid molecule, preferably RNA, according to the invention, encodes, in its at least one coding region, at least one antigenic peptide or protein derived from an antigen bacterial, viral, protozoan or fungal.
[00117] [00117] — Preferably, said at least one antigenic peptide or protein encoded by at least one coding region of the artificial nucleic acid molecule, preferably RNA, of the invention may be derived from a bacterial, viral, protozoan antigen. zoan or fungal derived from Agrobacterium tumefaciens, Ajellomyces 'edition 870190141603, of 12/30/2019, p. 22066/22358 dermatitidis ATCC 60636, Alfapapillomavirus 10, ees orthohantavirus, ees virus CHI-7913, Aspergillus terreus NIH2624, Avian hepatitis E virus, Babesia microti, Bacillus anthracis, Bacteria, Betacoronavirus England 1, Blattella germanica, Bordetella pertussis, Borna virus Giessen strain He/80, Borrelia burgdorferi B31, Borrelia burgdorferi CA12, Borrelia burgdorferi N40, Borrelia burgdorferi ZS7, Borrelia garinii IP90, Borrelia hermsii, Borreliella afzelii, Borreliella burgdorferi, Borreliella garinii, Bos taurus, Brucella melitensis, Brugia malayi, Bun - dibugyo ebolavirus, Burkholderia pseudomaliei, Burkholderia pseudomallei K96243, Campylobacter jejuni, Campylobacter upsaliensis, Candida albicans, Cavia porcellus, Chikungunya virus, Chikungunya virus MY/08/065, Chikungunya virus Singapore/11/2008, Chikungunya virus strain LR2006 OPY1 IMT /Reunion Island/2006, Chikungunya virus strain S27-African prototype, Chlamydia pneumoniae, Chlamydia trachomatis, Chlamyd ia trachomatis Serovar D, Chlamydiae, Clostridioides difficile, Clostridium difficile BIINAP1/027, Clostridium tetani, Convict Creek 107 virus, Corynebacterium diphtheriae, Cowpox virus (Brighton Red) White-pock, Coxsackievirus A16, Coxsackievirus A9, Coxsackievirus B1, Coxsackievirus B2 , Coxsackievirus B3, Coxsackie-virus B4, Crimean-Congo hemorrhagic fever orthonairovirus, Cryptosporidium parvum, Dengue virus, Dengue virus 1, Dengue virus 1 Nauru/West Pac/1974, Dengue virus 1 PVP159, Dengue virus 1 Singapo- re/S275/1990, Dengue virus 2, Dengue virus 2 D2/SG/05K4155DK1/2005, Dengue virus 2 Jamaica/1409/1983, Dengue virus 2 Puerto Rico/PR159-S1/1969, Dengue virus 2 strain 43, Dengue virus 2 Thailand/16681/84, Dengue virus 2 Thailand/NGS- C/1944, Dengue virus 3, Dengue virus 4, Dengue virus 4 Dominica/814669/1981, Dengue virus 4 Thailand/0348/1991, Dengue virus type 1 Hawaii, Ebola virus - Mayinga, Zaire, 1976, Ebolavirus, Echinococcus granulosus, Echinococcus multilocular is, Echovirus E11, Echo-'etition 870190141603, of 12/30/2019, p. 22067/22358 virus E9, Ehrlichia canis str.
[00118] [00118] According to other preferred embodiments, the artificial nucleic acid molecule, preferably RNA, according to the invention, encodes, in its at least one coding region, at least one antigenic peptide or protein derived from an antigen allogeneic.
[00119] [00119] An "allogeneic antigen" or "alloantigen" or "isoantigen" is an antigen existing in alternative (allelic) forms in a species, and may therefore induce alloimmunity (or isoimmunity) in members of the same species, by for example, after blood transfusion, tissue or organ transplantation, or sometimes pregnancy. Typical allogeneic antigens include histocompatibility antigens and blood group antigens. In the context of the present invention, allogeneic antigens are preferably of human origin. The provision of an artificial nucleic acid, preferably RNA, which encodes an antigenic protein or peptide derived from an allogeneic antigen can, for example, be used to induce immune tolerance towards said allogeneic antigen.
[00120] [00120] — Preferably, the at least one antigenic peptide or protein encoded by at least one coding region of the artificial nucleic acid molecule, preferably RNA, of the invention may be derived from an allogeneic antigen derived or selected from UDP-glucuronosyltransferase precursor 2B17, MHC class antigen | HLA-A2, precursor of clotting factor VIII, clotting factor VIII, precursor of thrombopoietin (megakaryocyte colony-stimulating factor) (myeloproliferative leukemia virus oncogene ligand) (C-mpl ligand) (ML) (factor of megakaryocyte development and growth) (MGDF), Integrin beta-3, histocompatibility 870190141603, of 12/30/2019, p. 22076/22358
[00121] [00121] According to other preferred embodiments, the artificial nucleic acid molecule, preferably RNA, according to the invention, encodes, in its at least one coding region, at least one antigenic peptide or protein derived from an autoan - tigen.
[00122] [00122] A "self antigen" is an endogenous "self" antigen that — despite being a normal body constituent — induces an authentication reaction 870190141603, 12/30/2019, p. 22078/22358 is immune in the host. In the context of the present invention, autoantigens are preferably of human origin. The provision of an artificial nucleic acid, preferably RNA, encoding an antigenic peptide or protein derived from an autoantigen can, for example, be used to induce immune tolerance to said autoantigen.
[00123] [00123] — Preferably, the at least one antigenic peptide or protein encoded by at least one coding region of the artificial nucleic acid molecule, preferably RNA, of the invention may encode an antigenic peptide or protein derived from an autoantigen derived or selected 60 kDa chaperonin 2, Lipoprotein LpgH, melanoma antigen recognized by T 1 cells, class A polypeptide-related sequence | MHC, parent protein, structural polyprotein, Tyrosinase, Myelin proteolipid protein, Epstein-Barr 1 nuclear antigen, GP350 envelope glycoprotein, Genomic polyprotein, Collagen alpha-1(11) chain, Aggrecan core protein, stimulatory hormone receptor melanocyte, acetylcholine receptor alpha subunit, 60 kDa heat shock protein, mitochondrial, Histone H4, Myosin-11, Glutamate decarboxylase 2, 60 kDa chaperonin, PqagC-like protein, Thymosin beta-10, basic protein myelin, Epstein-Barr 4 nuclear antigen, PMEL melanocyte protein, HLA class II histocompatibility antigen, beta chain 1 DQ latent membrane protein 2, beta-3 integrin, nucleoprotein, L10 60S ribosomal protein, BOLF1 protein, Acid ribosomal protein P2 608, latent membrane protein 1, collagen alpha-2 (VI) chain, Exodeoxyribonuclease V, gamma, BZLF1 transactivator protein, S-arrestin, clas histocompatibilide antigen if | of HLA, alpha chain A-3, Protein CT 579, Matrin-3, envelope glycoprotein B, ATP-dependent zinc metalloprotease FtsH, small nuclear ribonucleoprotein 'edition 870190141603, dated 12/30/2019, pg. 22079/22358
[00124] [00124] According to other preferred embodiments, the 'ethition molecule 870190141603, of 12/30/2019, p. 22096/22358 of artificial nucleic acid, preferably RNA, according to the invention, encodes, in its at least one coding region, at least one antigenic peptide or protein derived from an allergen-Co.
[00125] [00125] An "allergen" is any substance, in particular a protein or peptide, that induces allergy, an abnormal immune reaction of the body to a foreign (previously encountered) substance typically introduced by inhalation, ingestion, injection, or contact with the skin.
[00126] [00126] Preferably, the at least one antigenic peptide or protein encoded by the at least one coding region of the artificial nucleic acid molecule, preferably RNA, of the invention may be derived from an allergen derived or selected from Allergen Pen n 18, Antigen Name, Ara h 2.01 Allergen, Melanoma Antigen Recognized by T cells 1, Nonspecific Lipid Transfer Protein (LTP) Precursor (Mal d 3 Allergen), Ovalbumin, Parvalbumin beta, VA Allergen Precursor to pollen Lol p, precursor to pollen allergen Phl p 5b, pru p 1, pollen allergen Phl p 5a, precursor to allergen Der p 1, precursor to pollen allergen KBG 60, major allergen Tur c1-Turbo cornutus, mite group 2 allergen Lep d 2 precursor, Lep D2 precursor, major latex allergen Hev b 5, major allergen Cor a 1.0401, major pollen allergen Art v 1, major pollen precursor Bet v 1-A, pre- beta-lactoglobulin cursor, precursor of inhibitor 0.28 alpha-amylase (CIII) (WMAI-1) inhibitor, group V allergen Phl p 5.0203, polygalacturonase precursor, pollen allergen Phl pl, Der f 2 allergen, probable nonspecific precursor of lipid transfer protein 2 , precursor of allergen venom 5, precursor of pollen allergen Phl p 1, Allergen group V, chain A, crystal structure of calcium-binding pollen allergen Phl P 7 (Polcalcin) at 1.75 Angstroem, Allergen Tri r 2, precursor of pathogen-related proteins, precursor of 'etition 870190141603, of 12/30/2019, p. 22097/22358
[00127] [00127] According to preferred embodiments, the artificial nucleic acid molecule, preferably RNA, of the invention further encodes, in its at least one coding region, at least one signal peptide.
[00128] [00128] A "signal peptide" (sometimes referred to as a signal sequence, targeting signal, locating signal, locating sequence, transit peptide, leader sequence, or leader peptide) is typically an N- short terminal (5-30 amino acids).
[00129] [00129] According to preferred embodiments, the nucleic acid sequence encoding said at least one signal peptide may be fused (in frame) to a nucleic acid sequence encoding at least one amino acid sequence derived from IRS-Tepm OR The at least one antigenic peptide or protein. Therefore, expression of the artificial nucleic acid molecule, preferably RNA, of the invention may preferably result in a fusion protein comprising at least one signal peptide joined to (optionally via appropriate peptide linkers) said amino acid sequence. derived from IRSTepm €/or said antigenic peptide or protein. Said additional amino acid sequence preferentially directs the antigenic peptide or protein to the plasma membrane, where the antigenic peptides or proteins are preferentially anchored through the TM domain and recycled to MHC class | and, more preferably, MHC class |1, resulting in the improved presentation of both MHC class | and, preferably, MHC class II. The signal peptide preferentially aims to mediate or support the transport of the antigenic construct in a defined cellular compartment, in particular, the outer side of the plasma membrane.
[00130] [00130] In general, the present invention aims at combining any of the signal peptides described herein with any of the antigenic peptides or proteins, any of the additional IRTepm-derived amino acid sequences, any of the ligands, in any suitable order, in the antigenic fusion proteins encoded by the artificial nucleic acid molecules. 22107/22358 al, preferably RNAs, of the invention.
[00131] [00131] According to preferred embodiments, the artificial nucleic acid molecule, preferably RNA, of the invention may encode in its at least one coding region at least one signal peptide selected from the signal peptides indicated in Table 4 below, or a fragment, variant or derivative (preferably functional) of any of said signal peptides.
[00132] [00132] Accordingly, in preferred embodiments, the artificial nucleic acid molecule, preferably RNA, of the invention may encode in its at least one coding region an amino acid sequence comprising or consisting of an amino acid sequence, as defined by any one of SEQ ID NOs: 1 - 156, 76948 - 76951, or a fragment, variant or derivative (preferably functional) of any of said sequences, preferably comprising or consisting of an amino acid sequence having at least 5 %, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90 % and more preferably at least 95% or even 97% sequence identity to any such sequence.
[00133] [00133] Therefore, in preferred embodiments, the artificial nucleic acid molecule, preferably RNA, of the invention may comprise, in its at least one coding region, a nucleic acid sequence comprising or consisting of a sequence of nucleic acid as defined by any of SEQ ID NOs: 209 - 364, 417 — 572, 625 — 780, 833 — 988, 1041 — 1196, 1249 — 1404, 1457 — 1612, 1665 — 1820, 1873 — 2028, 2081 — 2236, 2289 — 2444, 2497 — 2652, 2705 — 2860, 76952 - 77003 or a fragment, variant or derivative (preferably functional) of any of said sequences, preferably comprising or consisting of a nucleic acid sequence having at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91% , 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, further edition 870190141603, from 12/30/2019, page 22139/22358 gives more preferably at least 90% and most preferably at least 95% or even 97% sequence identity to any such sequence. Binder (L)
[00134] [00134] According to preferred embodiments, the at least one artificial nucleic acid molecule coding region according to the invention further encodes e.g. at least one binder.
[00135] [00135] The term "linker" preferably refers to peptide linkers, i.e. typically short (i.e., comprising 1-150 amino acids, preferably 1-50 amino acids, more preferably 1 to 20 amino acids), sequences of linear amino acids connecting or linking two polypeptide sequences. Linkers according to the invention may be derived from any protein of human, animal, plant, bacterial or viral origin. Binders according to the invention may be naturally occurring or artificial (i.e. synthetic or non-naturally occurring) binders. Preferably, the ligand(s) is/are non-immunogenic, ie, they do not trigger an immune response. Linkers may be employed to connect or link at least two components of the antigenic fusion protein encoded by the artificial nucleic acid molecule, preferably RNA, of the invention. The coding region of the artificial nucleic acid molecule according to the invention may encode at least one linker, or a plurality of at least 2, 3, 4, 5, 6,7, 8, 9 or identical linkers. or different, as described in this document. In the event that a plurality of linkers are encoded by the artificial nucleic acid molecule, it is particularly preferred that the linkers differ in their amino acid sequence and/or nucleic acid sequence encoding the respective linkers.
[00136] [00136] Peptide ligands of interest are generally known in the art and can be classified into three types: ligands 'etition 870190141603, dated 12/30/2019, p. 22140/22358 flexible, rigid binders and cleavable binders. Flexible ligands are generally applied when the joined polypeptide sequences require a certain degree of movement or interaction. They are generally rich in small, non-polar (eg, Gly) or polar (eg, Ser or Thr) amino acids to provide good flexibility and solubility, and support the mobility of the connected polypeptide sequences. Exemplary flexible linker arm sequences typically contain about 4 to about 10 glycine residues. The incorporation of Ser or Thr can maintain the stability of the ligand in aqueous solutions by forming hydrogen bonds with water molecules, and therefore, reducing unfavorable interactions between the ligand and the protein moieties.
[00137] [00137] The most commonly used flexible ligands have sequences consisting mainly of extensions of Gly and Ser residues ("GS" ligand). An example of the most widely used flexible linker has the sequence of (Gly-Gly-Gly-Gly-Ser)n. By adjusting the copy number "n", the length of this GS linker can be optimized to achieve proper separation of protein domains, or to maintain necessary interdomain interactions. Aside from GS linkers, many other flexible linkers are known in the art. These flexible ligands are also rich in small or polar amino acids, such as Gly and Ser, but may contain additional amino acids, such as Thr and Ala, to maintain flexibility, as well as polar amino acids, such as Lys and Glu, to improve flexibility. the solubility. Rigid linkers can be used to ensure separation of joined polypeptide sequences and reduce steric interference or hindrance. Cleavable linkers, on the other hand, can be introduced to release free functional domains in vivo. For example, cleavable linkers can be Arg-Arg or Lys-Lys which are sensitive to cleavage with an enzyme such as cathepsin or trypsin. Chen et al. Adv Drug Deliv 'edition 870190141603, of 12/30/2019, p. 22141/22358
[00138] [00138] According to preferred embodiments, the artificial nucleic acid molecule, preferably RNA, of the invention encodes, in its at least one coding region, at least one linker, which is preferably a non-immunogenic linker, optionally comprising endowing or consisting of an amino acid sequence selected from: SGGSGGSGG, RR, LL, GGGGSGGGG6T, GGGGSGCGGGG, GPSL, GSTVAAPS, TVAAPSGS, GSTVAAPSGS, GGGGS, TVAAPS, GS, PAS, PAVPPP, TVSDVP, TGLDSP, HYGAEALERAG, AAY, AAAA, G , GS, GGS, OSG, SGG, GGG, GGGS, SGGG, GGGGSGS, GGGGS GGS, GGGGSGGGGS, GGGGSGGGGSGGGGS, AKTTPKLEE- GEFSEAR, AKTTPKLEEGEFSEARV, AKTTPKLGG, SAKTTPKLGG, AKTTPKLEEGEFSEARV, SAKTTP, SAKTTPKLGG, RADAAP, RA- DAAPTVS, RADAAAAGGPGS, RADAAAAGGGGS, SAKTTP, SAK- TTPKLGG, SAKTTPKLEEGEFSEARV, ADAAP, ADAAPTVSIFPP, TVAAP, TVAAPSVFIFPP, QPKAAP, QPKAAPSVTLFPP, AKTTPP, AKTTPPSVTPLAP, AKTTAP, AKTTAPSVYPLAP, ASTKGP, ASTKG-PSVFPPLAP, GENKVEYAPALMALS, GPAKELTQVOSGPS eV.
[00139] [00139] According to preferred embodiments, the artificial nucleic acid molecule, preferably RNA, of the invention encodes, in its at least one coding region, at least one linker, which is preferably a non-immunogenic linker, optionally comprising or consisting of an ethition amino acid sequence 870190141603, dated 12/30/2019, pg. 22142/22358 according to any one of SEQ ID NOs: 2937, 76400-76418, 77018-77058.
[00140] [00140] - Therefore, the artificial nucleic acid molecule, preferably RNA, of the invention preferably comprises, in its at least one coding region, a nucleic acid sequence comprising or consisting of a nucleic acid sequence according to any of SEQ ID NOs: 2936, 76494, 76569, 76475-76493, 76550-76568, 77059-77061 or a fragment, variant or derivative (preferably functional) thereof, preferably comprising or consisting of a nucleic acid sequence having at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91% , 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, still more preferably at least 90% and most preferably at least 95% or even 97% sequence identity to any of said sequences. Auxiliary T (TH) epitopes
[00141] [00141] The at least one coding region of the artificial nucleic acid molecule, preferably RNA, of the invention may preferably further encode f. at least one T helper epitope.
[00142] [00142] According to preferred embodiments, the nucleic acid sequence encoding said at least one T helper epitope may be fused (in frame) to a nucleic acid sequence encoding at least one IRS-derived amino acid sequence. Tepm OR The at least one antigenic peptide or protein. Therefore, expression of the artificial nucleic acid molecule, preferably RNA, of the invention may preferably result in a fusion protein comprising at least one T helper epitope attached (optionally via appropriate peptide linkers) to said issue 870190141603, of 30 /12/2019, pg. 22143/22358 amino acid sequence derived from IRSTepm and/or said antigenic peptide or protein. The expressed antigenic fusion protein is processed and its fragments (including T helper epitopes) are loaded into MHC molecules, where they are presented to and recognized by antigen-specific T cells.
[00143] [00143] The artificial nucleic acid molecule according to the invention can encode in its at least one coding region one or a plurality of two or more T helper epitopes. the combination of any of the T helper epitopes described herein with any of the antigenic peptides or proteins, any of the additional amino acid sequences derived from IRSTepm, any of the ligands, and any of the signal peptides, in any suitable order , in the antigenic fusion proteins encoded by the artificial nucleic acid molecules, preferably RNAs, of the invention.
[00144] [00144] The term "T helper epitope" refers to an antigenic determinant capable of binding to MHC molecules, preferably class II MHC molecules, thus being recognized by CD4+ T helper cells (Th). Preferably, such T helper epitopes induce or enhance the activation, differentiation and/or proliferation of CD4+ Th cells (generally referred to as "CDA4+ Th cell responses"). Activated CD4+ Th cells can preferentially (1) (directly or indirectly) induce or enhance cytotoxic T lymphocyte (CTL) differentiation and/or proliferation ("CTL responses"), and/or (2) (directly or indirectly). indirectly) to induce or increase the differentiation and/or proliferation of antibody-producing plasma cells ("B cell responses"). In this sense, "directly or indirectly" means that activated CD4+ Th cells can induce or enhance the respective immune responses either by direct interaction with target cells or their precursors (e.g. B cells) or indirectly by interaction with 'etition 870190141603, of 12/30/2019, page 22144/22358 other cells (eg, dendritic cells) which, in turn, interact directly with target cells or their precursors (eg, untreated (naive) CD8+ T cells)).
[00145] [00145] “Thus, helper T epitopes can advantageously be used to induce or enhance CD4+ Th cell responses, CTL responses (preferably including enhanced cell-mediated immunity and, for example, improved antitumor or antiviral immune responses) and /or to induce or enhance B cell responses (preferably including increased antibody production and, for example, improved antibacterial immune responses) to the antigenic peptide or protein encoded by the artificial nucleic acid molecule, preferably RNA, of the invention.
[00146] [00146] T helper epitopes according to the invention may be derived from any protein of human, animal, plant, bacterial or viral origin. Auxiliary T epitopes according to the invention may be naturally occurring or artificial (ie synthetic or non-naturally occurring) epitopes. It may be preferred to employ generic T helper cell epitopes, that is, promiscuous or permissive (generic) T helper epitopes, which are capable of interacting with most MHC class II haplotypes, and therefore preferentially inducing or enhance Tr cell responses, CTL responses, or B cell responses in most human or other mammalian populations.
[00147] [00147] In the context of the present invention, preferred T helper epitopes include T helper epitopes disclosed in WO 2001/062284 , WO 2010/023247 , WO 2004/058297 , WO 2004/000873 and WO 2006/113792 .
[00148] Particularly preferred T helper cell epitopes in the context of the present invention include naturally occurring or artificially occurring T helper epitopes derived from PADRE; hepatitis virus 'edition 870190141603, of 12/30/2019, p. 22145/22358
[00149] [00149] "PADRE" (pan DR epitope peptides), as described in WO 95/07707 and in Alexander J et al., 1994, Immunity 1: 751-761, with or without carrying D-amino acids on the C- and N -terminals, are preferred T-helper epitopes in the context of the present invention.
[00150] [00150] According to preferred embodiments, the artificial nucleic acid molecule, preferably RNA, of the invention encodes, in its at least one coding region, at least one T helper epitope comprising or consisting of an amino acid sequence according to any one of SEQ ID NOs: 3083 - 3294, or a fragment, variant or derivative (preferably functional) of any of said sequences, preferably comprising or consisting of an amino acid sequence having at least 5%, 10 %, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and more preferably at least 95% or even 97% sequence identity to any of said sequences.
[00151] [00151] - Therefore, the artificial nucleic acid molecule, preferably RNA, of the invention preferably comprises, in its at least one coding region, a nucleic acid sequence comprising or consisting of a nucleic acid sequence according to any of SEQ ID NOs: 3295 — 3506, 3507 — 3718, or a fragment, variant or derivative (preferably functional) of any of said sequences, preferably comprising or consisting of a nucleic acid sequence having at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92% , 93%, 94%, 95%, 96%, 97%, 98%, or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least at least 90% and more preferably at least 95% or even 97% sequence identity to any of said sequences.
[00152] [00152] As indicated above, the artificial nucleic acid molecules, preferably RNAs, of the invention may encode, in their at least one coding region, at least one antigenic fusion protein as defined herein. Said antigenic fusion protein may preferentially be expressed (in particular, translated) in the cytoplasm of recipient host cells, processed into fragments and loaded onto MHC class | and preferably also MHC class II. The different components of the antigenic fusion protein each preferentially play a different functional role. Antigen/epitope presentation typically requires degradation of the antigenic fusion protein in the endosomal lysosomal compartment. The additional amino acid sequence derived from IRSTepm (in particular, TM and, optionally, CD domains) preferentially directs the traffic of the peptide 870190141603, of 12/30/2019, p. 22147/22358 antigenic deos or proteins fused to the plasma membrane, and by recycling to the desired MHC processing compartments, where they are degraded and loaded into MHC class | and, in particular, also class II MHC molecules for presentation to antigen-specific T cells. Helper T epitopes preferentially enhance the T helper cell response. Without wishing to be bound by a specific theory, CD4+ T cell assistance is believed to be critical for the effective induction of CTL responses and antitumor immunity. Preferably, the unique design of the inventive artificial nucleic acid molecules, preferably RNAs, provides for simultaneous presentation of MHC | and MHC II, and targets both CD4+ and CD8+ T cell responses, resulting in heightened overall immune responses and an enhanced therapeutic/prophylactic effect.
[00153] [00153] According to preferred embodiments, the artificial nucleic acid molecule, preferably RNA, of the invention comprises at least one coding region of the following Formula (II), preferably in the 53' direction: -(SIG)a -(L)b-[(AN)--(L)ale-[(TH)m-(L)nlo-(TMD/TMCD),- (1) wherein "SIG" encodes a signal peptide, preferably as defined herein, "L" encodes a linker sequence, preferably as defined herein, "AN" each independently encodes an antigenic peptide or protein, preferably as defined herein, "TH" encodes a T helper epitope , preferably as defined herein, "TMD/TMCD" encodes an amino acid sequence derived from an immune response signal transduction protein location 870190141603, dated 12/30/2019, pg. 22148/22358 located in the outer plasma membrane, preferably a transmembrane domain, preferably as defined in this document, and optionally a cytoplasmic domain, b, d, m, n, o is each independently an integer selected from 0, 1, 2, 3,4,5,6,7,8,9 and 10, a, c, e, p is each independently an integer selected from 1, 2, 3, 4, 5,6,7,8,9 and 10.
[00154] [00154] Preferably, a, e, and p can be 1 - that is, the artificial nucleic acid molecule, preferably RNA, of the invention encodes in its at least one coding region a signal peptide, as defined herein, linked (optionally via a suitable binding peptide as defined herein) to an antigenic peptide or protein as defined herein, which is (optionally via a suitable binding peptide as defined herein) linked to a transmembrane domain derived from IRSTepm (optionally linked to cytoplasmic domain) as defined in this document. More preferably, ab, c, d, e, m, n, o and p may each be 1, i.e. the coding region of the artificial nucleic acid molecule, preferably RNA, of the invention encodes one of each of the components described in this document. The individual components of the antigenic fusion protein (SIG, L, AN, TH, TMD/TMCD) can be arranged (and thus encoded) in any suitable order. RNAs
[00155] [00155] The artificial nucleic acid molecule of the invention may preferably be an RNA. It will be understood that the term "RNA!" refers to ribonucleic acid molecules characterized by the specific succession of their nucleotides joined to form said molecules (ie, their RNA sequence). The term "RNA" can thus be used to refer to RNA molecules or 'ethition sequences' 870190141603, dated 12/30/2019, p. 22149/22358
[00156] [00156] In preferred embodiments, the RNA may be an mRNA, a viral RNA, or a replicon RNA, preferably an mRNA.
[00157] [00157] In embodiments, the artificial RNA is a circular RNA. As used herein, "circular RNA" or "circRNA" shall be considered a circular polynucleotide that can encode at least one antigenic peptide or protein as defined herein. For example, said circular RNA may comprise at least one coding sequence encoding at least one LASV-derived antigenic peptide or protein, or a fragment or variant thereof. Furthermore, said circRNA may comprise at least one 3'-UTR and/or 5-UTR, as defined herein. The production of circRNAs can be carried out using various methods provided in the art. For example, US6210931 teaches a method of synthesizing CircRNAs by inserting DNA fragments into a plasmid containing sequences capable of spontaneous cleavage and self-circulation. US5773244 teaches how to produce circRNAs by making a DNA construct encoding an RNA cyclase ribozyme, expressing the DNA construct as RNA, and then allowing the RNA to self-divide, which produces an intron-free circRNA in vitro. WO1992/001813 teaches a process for manufacturing single-chain circular nucleic acids by synthesizing a line-etition polynucleotide 870190141603, of 12/30/2019, p. 22150/22358 ar, combining the linear nucleotide with a complementary ligation oligonucleotide under hybridization conditions and ligating the linear polynucleotide. One skilled in the art can also use the methods provided in WOZ2015/034925 or WO2016/011222 to produce circular RNA. Therefore, the methods for producing circular RNA, as provided in US6210931, US5773244, WO1992/001813, WO2015/034925 and WO2016/011222, can suitably be used to generate the artificial RNA, i.e. the CircRNA of the invention.
[00158] [00158] In embodiments, the artificial RNA is a replicon RNA. The term "replicon RNA" will be recognized and understood by one skilled in the art and is intended, for example, to be an optimized self-replicating artificial RNA. These constructs may include replication elements (replicase) derived, for example, from alphaviruses and the replacement of structural virus proteins with the artificial nucleic acid of interest. Alternatively, the replicase can be provided in an independent nucleic acid construct, comprising a replicase sequence derived, for example, from Semliki forest virus (SFV), Sindbis virus (SIN), Venezuelan equine encephalitis virus ( VEE), Ross-River virus (RRV), or other viruses belonging to the alphavirus family. Downstream of the replicase may be a subgenomic promoter that controls replication of the artificial RNA of the first aspect.
[00159] [00159] In particularly preferred embodiments, the artificial nucleic acid of the present invention is an RNA, more preferably, an mRNA.
[00160] [00160] The term "MRNA" (short for "messenger RNA") will be recognized and understood by those skilled in the art, for example, and is intended to be a ribonucleic acid molecule, that is, a polymer made up of nucleotides. These nucleotides are usually 'edition 870190141603, dated 12/30/2019, pg. 22151/22358 connected to each other along the so-called skeleton. The skeleton is formed by phosphodiester bonds between the sugar, that is, ribose, of a first and a phosphate moiety of an adjacent second monomer. The specific succession of monomers is called the RNA sequence. The mRNA usually provides the coding sequence that is translated into an amino acid sequence of a particular peptide or protein. Typically, an mRNA comprises a 5' cap structure, UTR elements and a 3' poly(A) sequence.
[00161] [00161] The artificial RNA, preferably the MRNA of the invention, can be prepared using any method known in the art, including chemical synthesis, such as, for example, solid-phase RNA synthesis, as well as in vitro methods, such as in vitro RNA transcription.
[00162] [00162] In a preferred embodiment, the artificial RNA, preferably mMRNA, is obtained by in vitro RNA transcription.
[00163] [00163] Therefore, the RNA of the invention is an in vitro transcribed RNA, preferably an in vitro transcribed mRNA. Mono-, bi- or multicistronic RNAs
[00164] [00164] The artificial nucleic acid molecule, preferably RNA, may be mono-, bi- or multicistronic, preferably as defined herein.
[00165] [00165] "Bi or multicistronic" RNAs typically comprise two (bicistronic) or more (multicistronic) open reading frames (ORF). An "open reading frame" is a sequence of codons that is translatable into a peptide or protein.
[001668] [001668] The ORFs in a bi- or multicistronic artificial nucleic acid molecule can be identical or different from each other. "Identical" ORFs share a % sequence identity of 100%, and encode identical antigenic fusion proteins, whereas "different" ORFs share a % sequence identity. page 22152/22358 less than 100%, such as 99% or less, 90% or less, 80% or less, 70% or less, 60% or less, 50% or less, 40% or less, 30% or less, 20% or less, 10% or less, 5% or less, or 2% or less, and encode identical (due to degeneration of the genetic code) or different antigenic fusion proteins.
[00167] [00167] It may be preferred that "bi- or multicistronic" artificial nucleic acid molecules, preferably RNAs, encode different antigenic fusion proteins. For example, bi- or multicistronic artificial nucleic acid molecules, preferably RNAs, can each encode, for example, at least two, three, four, five, six or more (preferably different) antigenic fusion proteins. , as in this document.
[00168] [00168] The ORFs in a bi- or multicistronic artificial nucleic acid molecule, preferably RNA, encoding two or more antigenic fusion proteins (identical or different), as defined herein, may be separated by at least one IRES sequence (site internal ribosomal input). The term "IRES" (internal ribosomal entry site) refers to an RNA sequence that allows translation to begin. An IRES may function as a single ribosomal binding site, but may also serve to provide a bi- or even multicistronic artificial nucleic acid molecule, preferably RNA, as defined above, which encodes various antigenic fusion proteins (identical or different). ), which are translated by the ribosomes independently of each other.
[00169] [00169] Examples of IRES sequences, which can be used according to the invention, are those derived from picornaviruses (e.g. FMDV), pestivirus (CFFV), poliovirus (PV), encephalomyocarditis virus (ECMV) , foot-and-mouth disease virus (FMDV), hepatitis C virus (HCV), classical swine fever virus (CSFV), mouse leukoma virus (MLV), simian immunodeficiency virus (SIV) or etiology virus 870190141603 , of 12/30/2019, p. 22153/22358 cricket paralysis (CrPV).
[00170] [00170] Preferably, the artificial nucleic acid molecule, preferably RNA, comprises a length of from about 50 to about 20,000, or 100 to about 20,000 nucleotides, preferably from about 250 to about 20,000 nucleotides, more preferably - preferably from about 500 to about 10000, even more preferably from about 500 to about 5000.
[00171] [00171] The artificial nucleic acid molecule, preferably RNA, of the invention may also be single-stranded or double-stranded. When provided as a double-stranded RNA, the artificial nucleic acid molecule preferably comprises a sense strand and a corresponding antisense strand. Nucleic Acid Modifications
[00172] [00172] The artificial nucleic acid molecules, preferably RNAs, of the invention may be provided in the form of modified nucleic acids. Suitable nucleic acid modifications considered in the context of the present invention are described below.
[00173] [00173] - Preferably, the at least one artificial nucleic acid molecule, preferably RNA (sequence) of the invention, is modified as defined herein. A "modification" as defined herein preferably leads to a stabilization of said artificial nucleic acid molecule, preferably RNA. More preferably, the invention thus provides a "stabilized" artificial nucleic acid molecule, preferably RNA.
[00174] [00174] Preferably, the artificial nucleic acid molecule, preferably RNA, of the invention may thus be provided as a "stabilized" artificial nucleic acid molecule, preferably RNA, in particular MRNA, i.e. which is essentially resistant to attempt degradation in vivo (eg by an exo- or endonucleation 870190141603, dated 12/30/2019, pg. 22154/22358 clease).
[00175] [00175] This stabilization can be achieved, for example, by a modified phosphate backbone of the artificial nucleic acid molecule, preferably RNA. A backbone modification in connection with the present invention is a modification wherein the backbone phosphates of nucleotides contained in the artificial nucleic acid molecule molecule, preferably RNA, are chemically modified. The nucleotides that can be preferably used in this connection contain, for example, a phosphorothioate-modified phosphate backbone, preferably at least one of the phosphate-oxygen contained in the phosphate backbone being replaced by a sulfur atom. The stabilized artificial nucleic acid molecule, preferably RNAs, may further include, for example: non-ionic phosphate analogues, such as, for example, alkyl and aryl phosphonates, in which the charged phosphonate-oxygen is substituted. followed by an alkyl or aryl group, or phosphodiesters and alkylphosphotriesters, in which the charged oxygen residue is present in alkylated form. Such backbone modifications typically include, without limitation, modifications from the group consisting of methylphosphonates, phosphoramidates, and phosphorothioates (e.g., cytidine-5'-O-(1-thiophosphate)).
[00176] [00176] In the following, specific modifications are described, which are preferably capable of "stabilizing" the artificial nucleic acid molecule, preferably RNA, of the invention. Chemical Modifications
[00177] [00177] The term "modification", as used herein, may refer to chemical modifications comprising backbone modifications as well as sugar modifications or base modifications.
[00178] [00178] In this context, an artificial nucleic acid molecule 'edition 870190141603, of 12/30/2019, p. 22155/22358
[00179] [00179] “A backbone modification in connection with the present invention is a modification in which backbone phosphates of nucleotides contained in said artificial nucleic acid molecule, preferably RNA herein, are chemically modified. A sugar modification in connection with the present invention is a chemical modification of the sugar of the nucleotides of the artificial nucleic acid molecule, preferably RNA. Furthermore, a base modification in connection with the present invention is a chemical modification of the base portion of the nucleotides of the artificial nucleic acid molecule, preferably RNA. In this context, the nucleotide analogs or modifications are preferably selected from nucleotide analogs, which are applicable to transcription and/or translation. Sugar Modifications:
[00180] [00180] (chemically) modified nucleic acids, in particular artificial nucleic acid molecules according to the invention, may comprise sugar modifications, i.e. nucleosides/nucleotides which are modified in their sugar moiety.
[00181] [00181] For example, the 2' hydroxyl (OH) group can be modified or substituted by a number of different "oxy" or "deoxy" substituents. Examples of modifications of the "oxy"-2'-hydroxyl group include, but are not limited to, alkoxy or aryloxy (-OR, e.g., R = H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar); polyethylene glycols (PEG), -O(CH2CH20)hCH2CH2OR; "blocked" nucleic acids (LNA), in which the 2' hydroxyl is connected, for example, by a methylene bridge, to the 4' carbon of the same ribose sugar; and amino groups (-O-amino, in issue 870190141603, 12/30/2019, pg. 22156/22358 that the amino group, e.g. NRR, can be alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino or diheteroarylamino, ethylene diamine, polyamino) or aminoalkoxy.
[00182] "Deoxy" modifications include hydrogen, amino (e.g., NH>z; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino or amino acid); or the amino group may be attached to the sugar through a linker, wherein the linker comprises one or more of the C, N and O atoms.
[00183] [00183] The sugar group may also contain one or more carbons that have the opposite stereochemical configuration to the corresponding carbon in ribose. Thus, a modified artificial nucleic acid molecule, preferably RNA, may include nucleotides containing, for example, arabinose as a sugar. Skeleton Modifications:
[00184] [00184] (chemically) modified nucleic acids, in particular artificial nucleic acid molecules, according to the invention, may comprise backbone modifications, i.e. nucleosides/nucleotides which are modified in their phosphate backbone.
[00185] [00185] Backbone phosphate groups can be modified by replacing one or more oxygen atoms with a different substituent. In addition, modified nucleosides and nucleotides may include the complete replacement of an unmodified phosphate moiety with a modified phosphate as described herein.
[00186] [00186] “Examples of modified phosphate groups include, but are not limited to, phosphorothioate, phosphoroselenates, borane phosphates, borane phosphate esters, hydrogen phosphonates, phosphoroamidates, alkyl or aryl phosphonates, and phosphotriesters. Phosphorodithioates have both non-bonding oxygens replaced by sulfur. The phosphate ligand can also be modified by replacing a bonding oxygen with nitrogen (bridged phosphoroamidates), sulfur (bridged phosphorothioates 870190141603, dated 12/30/2019, pg. 22157/22358 te) and carbon (methylene -bridged phosphonates). Base Modifications:
[00187] [00187] (chemically) modified nucleic acids, in particular artificial nucleic acid molecules according to the invention, may comprise (nucleo-)base modifications, i.e. nucleosides/nucleotides which are modified in their portion nucleobase.
[00188] [00188] Examples of nucleobases found in RNA include, but are not limited to, adenine, guanine, cytosine, and uracil. For example, the nucleosides and nucleotides described herein may be chemically modified on the major groove face. In some embodiments, the major groove chemical modifications may include an amino group, a thiol group, an alkyl group, or a halo group.
[00189] [00189] The artificial nucleic acid molecule, preferably RNA, of the invention may comprise modified nucleosides selected from 2-amino-6-chloropurine-riboside-S'-triphosphate, 2-Aminopurine-riboside-5'"-triphosphate; 2-aminoadenosine-5'"-triphosphate, 2-Amino-2"-deoxycytidine-triphosphate, 2-thiocytidine-5'-triphosphate, 2-thiouridine-S5'-triphosphate, 2'-Fluorothymidine-5'"- triphosphate, 2'-O-Methyl-inosine-5'-triphosphate, 4-thiouridine-5'-triphosphate, 5-aminoallylcytidine-5'-triphosphate, 5-aminoallyluridine-B5'-triphosphate, 5-bromocytidine-5' -triphosphate, 5-bromouridine-5'-triphosphate, 5-Bromo-2'-deoxycytidine-5'-triphosphate, 5-Bromo-2'-deoxyuridine-5'-triphosphate, 5-iodocytidine-5'-triphosphate , 5-lodo-2'-deoxycytidine-5'-triphosphate, B5-iodouridine-5'-triphosphate, 5-lodo-2'-deoxyuridine-5'-triphosphate, 5-methyl-cytidine-5'-triphosphate, 5 -methyluridine-5'-triphosphate, 5-Propinyl-2'-deoxycytidine-5'-triphosphate, 5-Propinyl-2'-deoxyuridine-S5'-triphosphate, 6-azacytidine-5'-triphosphate, 6 -azauridine-5'-triphosphate, 6-chloropurine-riboside-5S'"-triphosphate, 7-deazaadenosine-5'"-triphosphate, 7-deazaguanosine-5'"-triphosphate, 8-azaadenosine-5'-triphosphate, 8 -azidoadenosine-5'"-triphosphate, benzimidazole-riboside-5'-triphosphate, N1-methyladenosine-5'"-triphosphate, N1-methylguanosine-5'-triphosphate, N6-methyladenosine-S5'"-triphosphate , O6-methylguanosine' ethition 870190141603, of 12/30/2019, pg. 22158/22358
[00190] [00190] The artificial nucleic acid molecule, preferably RNA, of the invention may comprise modified nucleosides selected from pyridin-4-0na ribonucleoside, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine , 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurine-methyluridine - 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thiouridine, 4-methoxy-pseudouridine, and 4-methoxy-2-thio-pseudouridine, or combinations thereof.
[00191] [00191] The artificial nucleic acid molecule, preferably RNA, of the invention may comprise modified nucleosides selected from B5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5 -hydroxymethylcytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudo-cytidine , 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularin, 5-aza-zebularin, 5-methyl-zebularin, 5-aza-2-thio-zebularin, 2 -thio-zebularin, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, and 4-methoxy-1-methyl-pseudo-isocytidine, or combinations thereof.
[00192] [00192] The artificial nucleic acid molecule, preferably RNA, of the invention may comprise modified nucleosides selected from 2-aminopurine, 2,6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7 -deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyladenosine , N6-methyladenosine, N6-isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyladenosine, N6-threonylcarbamoyladenosine, 2-methylthio-N6-threonyl carbamoyladenosine, N6,N6-dimethyladenosine, 7-methyladenine, 2-methylthioadenine, and 2-methoxyadenine, or combinations thereof.
[00193] [00193] The artificial nucleic acid molecule, preferably RNA, of the invention may comprise modified nucleosides selected from inosine, 1-methyl-inosine, wiosine, wibutosine, 7-deazaguanosine, 7-deaza-8-aza-guanosine , 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine , 6-methoxyguanosine, 1-methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl -6-thio-guanosine, and N2,N2-dimethyl-6-thio-guanosine, or combinations thereof.
[00194] [00194] The artificial nucleic acid molecule, preferably RNA, of the invention may comprise nucleotides modified on the major groove face, for example, by substituting C-5 hydrogen of uracil with a methyl group or a halo group, optionally selected. 5'-O-(1-thiophosphate)-adenosine, 5'-O-(1-thiophosphate)-cytidine, 5'-O-(1-thiophosphate)-guanosine, 5'-O-(1-thiophosphate) )-uridine or 5'-O-(1-thiophosphate)-pseudouridine.
[00195] The artificial nucleic acid molecule, preferably RNA, of the invention may comprise nucleoside modifications selected from 6-aza-cytidine, 2-thio-cytidine, a-thio-cytidine, Pseudo-iso-ethition 870190141603, of 30 /12/2019, pg. 22160/22358 cytidine, 5-aminoallyl-uridine, S5-iodo-uridine, Ni-methyl-pseudouridine, 5,6-dihydrouridine, a-thio-uridine, 4-thio-uridine, 6-aza-uridine, 5 -hydroxy-uridine, deoxy-thymidine, 5-methyl-uridine, pyrrolo-cytidine, inosine, a-thio-guanosine, 6-methyl-guanosine, 5-methyl-cytidine, 8-oxo-guanosine, 7-deaza-guanosine , Ni-methyl-adenosine, 2-amino-6-Chloro-purine, N6-methyl-2-amino-purine, Pseudo-iso-cytidine, 6-Chloro-purine, N6-methyl-adenosine, α-thio-adenosine , 8-azido-adenosine, 7-deaza-adenosine.
[00196] [00196] Alternatively, a "modified" artificial nucleic acid molecule, preferably RNA, may comprise none of the chemical modifications (or any other chemical modification) described herein. Such modified artificial nucleic acids may, however, comprise a lipid modification or a sequence modification as described below. Lipid Modifications
[00197] [00197] Artificial nucleic acid molecules, preferably RNAs, of the invention may preferably contain at least one lipid modification.
[00198] Such a lipid-modified artificial nucleic acid molecule, preferably RNA, of the invention typically comprises (i) an artificial nucleic acid molecule, preferably RNA, as defined herein, (ii) at least one covalent linker - linked with said artificial nucleic acid molecule, preferably RNA, and (iii) at least one lipid covalently linked with the respective linker.
[00199] [00199] Alternatively, the lipid-modified artificial nucleic acid molecule, preferably RNA, comprises at least one artificial nucleic acid molecule, preferably RNA, and at least one (bifunctional) lipid covalently linked (without a linker) with the said artificial nucleic acid molecule, preferably RNA.
[00200] [00200] —Alternatively, the lipid-modified artificial nucleic acid molecule, preferably RNA, comprises (i) an artificial nucleic acid molecule, preferably RNA, (ii) at least one linker covalently linked with said artificial nucleic acid molecule , preferably RNA, and (iii) at least one lipid covalently linked with the respective linker, and also (iv) at least one (bifunctional) lipid covalently linked (without a linker) with said artificial nucleic acid molecule, preferably RNA.
[00201] [00201] In this context, it is particularly preferred that the lipid modification is present at the terminal ends of a linear artificial nucleic acid molecule, preferably RNA. Sequence Modifications
[00202] [00202] In accordance with preferred embodiments, the artificial nucleic acid molecule, preferably RNA, of the invention may be "sequence modified", i.e., may comprise at least one sequence modification as described below. Without wishing to be bound by a specific theory, such sequence modifications may increase the stability and/or improve the expression of the artificial nucleic acid molecules of the invention, preferably RNAs. Modification of Grade G/C
[00203] [00203] According to preferred embodiments, the artificial nucleic acid molecule, preferably RNA, more preferably MRNA, of the invention may be modified, and thus stabilized, by modifying its guanosine/cytosine (G/ C), preferably by modifying the G/C content of the at least one coding sequence. In other words, the artificial nucleic acid molecule, preferably RNA, of the invention, and preferably its sequence, can be modified by G/C.
[00204] [00204] “A nucleic acid sequence (preferably RNA) 'edition 870190141603, of 12/30/2019, p. 22162/22358
[00205] [00205] In preferred embodiments, the G/C content of the coding sequence of the artificial nucleic acid molecule, preferably RNA, of the invention is modified, particularly high, compared to the G/C content of the coding sequence. of the respective wild-type, i.e. unmodified, nucleic acid. The amino acid sequence encoded by the artificial nucleic acid molecule of the invention, preferably RNA, is preferably unmodified as compared to the amino acid sequence encoded by the respective wild-type nucleic acid, preferably RNA.
[00206] [00206] Such modification of the artificial nucleic acid molecule of the invention, preferably RNA, is based on the fact that the sequence of any RNA region to be translated is important for efficient translation of said RNA. Thus, the composition of RNA and the sequence of various nucleotides are important. In particular, sequences having a high content of G (guanosine)/C (cytosine) are more stable than sequences having a high content of A'etition 870190141603, of 12/30/2019, p. 22163/22358
[00207] [00207] “According to the invention, the codons of the artificial nucleic acid molecule of the invention, preferably RNA, may therefore preferably vary compared to the respective wild-type nucleic acid, preferably RNA, while maintaining at the same time the translated amino acid sequence, such that they include a high amount of G/C nucleotides.
[00208] [00208] Regarding the fact that several codons code for one and the same amino acid (the so-called degeneracy of the genetic code), the most favorable codons for stability can be determined (the so-called alternative codon usage). Depending on the amino acid to be encoded by the artificial nucleic acid molecule of the invention, preferably RNA, there are several possibilities for modifying its nucleic acid sequence compared to its wild-type sequence. In the case of amino acids, which are codon-encoded, which contain exclusively G or C nucleotides, no codon modification is necessary.
[00209] [00209] “Thus, the codons for Pro (CCC or CCG), Arg (CGC or CGG), Ala (GCC or GCG) and Gly (GGC or GGG) do not require any modification, since no A or U is present. In contrast, codons that contain A and/or U nucleotides can be modified by substituting other codons, which encode the same amino acids, but contain no A and/or U. Examples of these are: the codons for Pro can be modified from CCU or CCA for CCC or CCG; codons for Arg can be changed from CGU or CGA or AGA or AGG to CGC or CGG; codons for Ala can be changed from GCU or GCA to GCC or GCG; the codons for Gly can be changed from GGU or GGA to GGC or GGG. In other cases, although A or U nucleotides cannot be eliminated from the codons, it is nevertheless possible to reduce the content of A and U' ethition 870190141603, of 12/30/2019, p. 22164/22358 using codons that contain a lower content of A and/or U nucleotides.
[00210] [00210] — Preferably, the G/C content of the coding sequence of the artificial nucleic acid molecule, preferably RNA, of the invention is increased by at least 7%, more preferably by at least 15%, particularly preferably by at least 15%. minus 20% compared to the G/C content of the coding sequence of the respective wild-type nucleic acid, preferably RNA.
[00211] [00211] According to preferred embodiments, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, more preferably at least 70%, even more preferably at least 80%, and most preferably - essentially, at least 90%, 95% or even 100% of the replaceable codons in the coding region or the entire sequence of the wild-type RNA sequence are replaced, thus increasing the G/C content of said sequence.
[00212] [00212] In this context, it is particularly preferable to increase the G/C content of the artificial nucleic acid molecule, preferably RNA, of the invention, preferably of its at least one coding sequence, to the maximum (i.e., 100% replaceable codons) when compared to the respective wild-type nucleic acid sequence, preferably RNA.
[00213] [00213] According to a preferred embodiment, the present invention provides a nucleic acid sequence, preferably RNA, comprising at least one coding sequence comprising or consisting of any of the RNA sequences according to SEQ ID NOs: 417 - 624, 2915, 2916, 2932, 2935, 76671 - 76693, 76956 - 76959, 1249 - 1456, 76763 - 76785, 'edition 870190141603, of 12/30/2019, page. 22167/22358
[00214] [00214] Another preferred modification of the artificial nucleic acid molecule, preferably RNA, of the invention is based on the discovery that translation efficiency is also determined by a different frequency in the occurrence of tRNAs in cells. Thus, if so-called "rare codons" are present in the artificial nucleic acid molecule, preferably RNA, of the invention to a greater extent, the corresponding modified RNA sequence is translated to a significantly lesser degree than in the case where codons encoding tRNAs relatively "frequent" are present.
[00215] [00215] In some preferred embodiments, in the modified artificial nucleic acid molecule, preferably the RNAs defined herein, the region encoding a protein is modified compared to the corresponding region of the wild-type nucleic acid, preferably RNA, such that at least At least one codon of the wild-type sequence, which encodes a tRNA that is relatively rare in the cell, is exchanged for a codon, which encodes a tRNA that is relatively frequent in the cell and carries the same amino acid as the relatively rare tRNA.
[00216] [00216] Thus, the sequences of the artificial nucleic acid molecule, preferably RNA, of the invention are modified such that codons for which frequently occurring tRNAs are available are inserted. In other words, according to the invention, by this 'edition 870190141603, of 12/30/2019, p. 22168/22358 modification, all codons in the wild-type sequence, which encode a tRNA that is relatively rare in the cell, can, in each case, be exchanged for a codon, which encodes a tRNA that is relatively frequent in the cell. cell and which, in each case, carries the same amino acid as the relatively rare tRNA. Which tRNAs occur relatively frequently in the cell and which, in contrast, occur relatively rarely are known to a person skilled in the art; as, for example, Akashi, Curr. opinion Gene Dev. 2001, 11(6): 660-666. Codons, which use the most frequently occurring tRNA for the particular amino acid, eg codon Gly, which uses the most frequently occurring tRNA in the (human) cell, are particularly preferred.
[00217] [00217] According to the invention, it is particularly preferable to link the content of sequential G/C which is high, in particular maximized, in the modified artificial nucleic acid molecule, preferably RNA, of the invention with the "frequent" codons without modifying the amino acid sequence encoded by the coding sequence of said artificial nucleic acid molecule, preferably RNA. Such preferred embodiments allow for the provision of a particularly efficiently translated and stabilized (modified) artificial nucleic acid molecule, preferably RNA (or any other nucleic acid as defined herein).
[00218] [00218] The determination of a modified artificial nucleic acid molecule, preferably RNA, as described above (high G/C content; exchange of tRNAs) can be performed using the computer program explained in WO 02/098443, the contents of disclosure of which is included in its full scope in the present invention. Using this computer program, the nucleotide sequence of any desired nucleic acid, in particular RNA, can be modified with the aid of the genetic code or the degenerative nature of 'edition 870190141603 of 12/30/2019, p. 22169/22358 same, such that the maximum G/C content results, in combination with the use of codons encoding tRNAs that occur as frequently as possible in the cell, the amino acid sequence encoded by the modified nucleic acid, in particular RNA, preferably being unmodified compared to the unmodified sequence.
[00219] [00219] —Alternatively, it is also possible to modify just the G/C content or just the codon usage compared to the original sequence. Source code in Visual Basic 6.0 (development environment used: Microsoft Visual Studio Enterprise 6.0 with Servicepack 3) is also described in WO 02/098443. Modification of A/U Content
[00220] [00220] — Preferably, the A/U content in the environment of the ribosome binding site of the artificial nucleic acid molecule, preferably RNA, of the invention is high compared to the A/U content in the environment of the site of ribosome binding of its respective wild-type nucleic acid, preferably RNA.
[00221] [00221] This modification (a high A/U content around the ribosome binding site) increases the efficiency of ribosome binding to said artificial nucleic acid molecule, preferably RNA. Efficient binding of ribosomes to the ribosome binding site (Kozak sequence, SEQ ID NO: 3081), in turn, has the effect of efficient translation of the artificial nucleic acid molecule, preferably RNA. DSE Modifications
[00222] [00222] Preferably, the artificial nucleic acid molecule, preferably RNA, of the invention can be modified with respect to potentially destabilizing sequence elements. In particular, the coding sequence and/or the 5' and/or 3' untranslated region of said artificial nucleic acid molecule, preferably RNA, may be modified compared to the respective 'edition 870190141603, of 30/30'. 12/2019, page 22170/22358 wild-type nucleic acid, preferably RNA (or said other wild-type nucleic acid), such that it does not contain any destabilizing sequence elements, the encoded amino acid sequence of the modified artificial nucleic acid molecule, preferably RNA , preferably unmodified compared to its respective wild-type nucleic acid, preferably RNA (or said other wild-type nucleic acid).
[00223] [00223] It is known that, for example, in eukaryotic RNA sequences, destabilizing sequence elements (DSE) occur, to which signal proteins bind and regulate the enzymatic degradation of RNA in vivo. For further stabilization of the modified artificial nucleic acid molecule, preferably RNA, optionally in its at least one coding region, one or more of these modifications compared to the corresponding region of the wild-type nucleic acid, preferably RNA, may , therefore, be performed such that no or substantially no destabilizing sequence elements are contained therein.
[00224] [00224] “According to the invention, DSE present in the untranslated regions (3'- and/or 5-UTR) can also be eliminated from the artificial nucleic acid molecule, preferably RNA, by these modifications. Such destabilizing sequences are, for example, AU-rich sequences (AURES), which occur in 3'-UTR sections of various unstable RNAs (Caput et al., Proc. Natl. Acad. Sci. USA 1986, 83: 1670 to 1674). The artificial nucleic acid molecule, preferably RNA, of the invention is therefore preferably modified compared to the respective wild-type nucleic acid, preferably RNA (or said respective other wild-type nucleic acid), such that said artificial nucleic acid molecule, preferably RNA, does not contain such destabilizing sequences.
[00225] [00225] “Another preferred modification of the artificial nucleic acid molecule, preferably RNA, of the invention is based on the discovery that codons encoding the same amino acid typically occur at different frequencies. According to other preferred embodiments, in the modified artificial nucleic acid molecule, preferably RNA, the coding sequence is modified compared to the corresponding region of the respective wild-type nucleic acid, preferably RNA, such that the frequency of codons encoding the same amino acid corresponds to the naturally occurring frequency of that codon according to human codon usage, as, for example, shown in Table 5.
[00226] [00226] For example, in the case of the amino acid alanine (Ala) present in an amino acid sequence encoded by at least one coding sequence of the artificial nucleic acid molecule, preferably RNA, of the invention, the coding sequence of wild type is preferably adapted so that the codon "GCC" is used with a frequency of 0.40, the codon "GCT" is used with a frequency of 0.28, the codon "GCA" is used with a frequency of 0 .22 and the codon "GCG" is used with a frequency of 0.10 etc. (see Table 5).
[00227] [00227] According to a preferred embodiment, the present invention provides a nucleic acid sequence, preferably RNA, more preferably mRNA, comprising at least one coding sequence comprising or consisting of any of the RNA sequences according to the SEQ ID NOs: 833 - 1040, 76717 - 76739, 76964 - 76967, or a fragment or variant of any of these sequences. Sequences with Codon Optimization:
[00228] [00228] “As described above, preferably all codons of the wild-type sequence that encode a tRNA, which is relatively rare in the cell, can be exchanged for a codon that encodes a tRNA, which is relatively frequent in the cell and which , in each case, carries the same amino acid as the relatively rare tRNA.
[00229] [00229] Therefore, it is particularly preferred that the most frequent codons are used for each encoded amino acid (see Table 5, the most frequent codons are marked with asterisks). Such an optimization procedure increases the codon adaptation index (CAI) and, ultimately, maximizes the CAI. In the context of the invention, high CAI or maximized sequences are typically referred to as "codon-optimized" sequences and/or "High CAI" sequences' issue 870190141603, 12/30/2019, p. 22175/22358 and/or "maximized". Preferably, the artificial nucleic acid molecule, preferably RNA, of the invention may comprise at least one coding sequence, wherein the coding sequence is codon-optimized, as described in this document. More preferably, the codon adaptation index (CAI) of the at least one coding sequence is at least 0.5, at least 0.8, at least 0.9, or at least 0.95. More preferably, The Codon Adaptation Index (CAI) of the at least one coding sequence can be 1.
[00230] [00230] For example, in the case of the amino acid alanine (Ala) present in the amino acid sequence encoded by at least one coding sequence of the artificial nucleic acid molecule, preferably RNA, of the invention, the type coding sequence wild-type is adapted so that the most frequent human codon "GCC'" is always used for said amino acid, or for the amino acid Cysteine (Cys), the wild-type sequence is adapted so that the human codon most frequent "TGC" is always used for said amino acid etc.
[00231] [00231] According to a preferred embodiment, the present invention provides a nucleic acid sequence, preferably RNA, more preferably mRNA, comprising at least one coding sequence comprising or consisting of any of the RNA sequences according to the SEQ ID NOs: 834 - 1248, 76740 - 76762, 76968 - 76971, or a fragment or variant of any of these sequences. Optimized Sequences in C:
[00232] [00232] Preferably, the artificial nucleic acid molecule, preferably RNA, of the invention can be modified by modifying, preferably increasing, the cytosine (C) content of said artificial nucleic acid molecule, preferably RNA, in part. issue 870190141603, of 12/30/2019, page 22176/22358 cular, in its at least one coding sequence.
[00233] [00233] — Preferably, the C content of the coding sequence of the artificial nucleic acid molecule, preferably RNA, of the invention is modified, preferably high, compared to the C content of the coding sequence of the respective nucleic acid of wild type (unmodified). The amino acid sequence encoded by at least one coding sequence of the artificial nucleic acid molecule, preferably RNA, of the invention is preferably unmodified as compared to the amino acid sequence encoded by the respective wild-type nucleic acid , preferably RNA (or the respective other wild-type nucleic acid).
[00234] [00234] — Preferably, said modified artificial nucleic acid molecule, preferably RNA, is modified such that at least 10%, 20%, 30%, 40%, 50%, 60%, 70% or 80% or at least 90% of the theoretically possible maximum cytosine content or even a maximum cytosine content is reached.
[00235] [00235] — Preferably at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or even 100% of the codons of the wild-type nucleic acid sequence, preferably RNAs that are "cytosine content optimizable" are replaced with codons having a higher cytosine content than those present in the wild-type sequence.
[00236] [00236] It may be further preferred that some of the codons of the wild-type coding sequence are further modified, such that a codon for a tRNA relatively rare in the cell is exchanged for a codon for a tRNA relatively frequent in the cell, provided that the substituted codon for a relatively frequent tRNA carries the same amino acid as the relatively rare tRNA of the original wild-type codon. Preferably, all 'edition 870190141603, of 12/30/2019, p. 22177/22358 codons for a relatively rare tRNA are replaced by a codon for a tRNA relatively frequent in the cell, except for codons encoding amino acids, which are exclusively encoded by codons not containing any cytosine, or except for glutamine (Gln), which is encoded by two codons, each containing the same number of cytosines.
[00237] [00237] It may further be preferred that the modified artificial nucleic acid molecule, preferably RNA, is modified such that at least 80%, or at least 90% of the maximum theoretically possible cytosine content or even a maximum cytosine content is achieved through codons, which encode tRNAs relatively frequent in the cell, in which the amino acid sequence remains unchanged.
[00238] [00238] Due to the naturally occurring degeneration of the genetic code, more than one codon can code for a particular amino acid. Therefore, 18 out of 20 naturally occurring amino acids are encoded by more than one codon (with Tryp and Met being an exception), e.g. by 2 codons (e.g. Cys, Asp, Glu), by three codons ( eg Ile), by 4 codons (eg Al, Gly, Pro) or by 6 codons (eg Leu, Arg, Ser). However, not all codons encoding the same amino acid are used with the same frequency under in vivo conditions. Depending on each individual organism, a typical codon usage profile is established.
[00239] [00239] The term "optimizable cytosine content codon", as used within the context of the present invention, refers to codons, which exhibit a lower cytosine content than other codons encoding the same amino acid. Therefore, any wild-type codon, which can be replaced by another codon encoding the same amino acid and exhibiting a greater number of cytosines within that codon, is considered to be cytosine-optimizable (C-optimizable). Any substitution of a C-optimizable wild-type codon for 'edition 870190141603, 12/30/2019, pg. 22178/22358 specific C-optimized codon within a wild-type coding sequence increases its overall C content and reflects a C-enriched modified RNA sequence.
[00240] [00240] Preferably, the artificial nucleic acid molecule, preferably RNA, of the invention, and in particular its at least one coding sequence, may comprise or consist of a C-maximized sequence containing C-optimized codons for all potentially optimizable codons in C. Therefore, 100% or all of the theoretically replaceable C-optimizable codons are preferably replaced by C-optimized codons over the entire length of the coding sequence.
[00241] [00241] In this context, cytosine-optimizable codons are codons that contain a smaller number of cytosines than other codons encoding the same amino acid.
[00242] [00242] “Any one of the codons GCG, GCA, GCU encodes the amino acid Ala, which may be exchanged for the codon GCC encoding the same amino acid, and/or the codon UGU encoding Cys may be exchanged for the codon UGC encoding the same amino acid. amino acid, and/or the codon GAU encoding Asp may be switched to the codon GAC encoding the same amino acid, and/or the codon which UUU encoding Phe may be switched to the codon UUC encoding the same amino acid, and/or any of the codons GGG, GGA, GGU encoding Gly may be exchanged for the codon GGC encoding the same amino acid, and/or the codon CAU encoding the His may be exchanged for the codon CAC encoding the same amino acid, and/or any of the codons AUA , AUU encoding Ile can be replaced by the codon AUC, and/or 'edition 870190141603, dated 12/30/2019, p. 22179/22358 any of the codons UUG, UUA, CUG, CUA, CUU encoding Leu may be exchanged for the codon CUC encoding the same amino acid, and/or the codon AAU encoding Asn may be exchanged for the codon AAC encoding the same amino acid , and/or any of the codons CCG, CCA, CCU encoding Pro may be exchanged for the codon CCC encoding the same amino acid, and/or any of the codons AGG, AGA, CGG, CGA, CGU encoding Arg may be exchanged for codon CGC encoding the same amino acid, and/or any of the codons AGU, AGC, UCG, UCA, UCU encoding Ser can be exchanged for the codon UCC encoding the same amino acid, and/or any of the codons ACG, ACA, ACU encoding Thr may be exchanged for the codon ACC encoding the same amino acid, and/or any of the codons GUG, GUA, GUU encoding Val may be exchanged for the codon GUC encoding the same amino acid, and/or the codon encoding UAU encoding Tyr may be exchanged for codon UAC encoding the same amino acid.
[00243] [00243] In any of the above cases, the number of cytosines is increased by 1 per codon switched. The exchange of all non-optimized codons in C (corresponding to optimizable codons in C) of the coding sequence results in a maximized coding sequence in C. In the context of the invention, at least 70%, preferably, preferably at least 80%, more preferably at least 90%, of the non-optimized codons in C within the at least one coding sequence of the artificial nucleic acid molecule, preference 870190141603, of 12/30/2019, p. . 22180/22358 RNA, of the invention, optimized codons are substituted in C.
[00244] [00244] It may be preferred that for some amino acids, the percentage of C-optimizable codons replaced by C-optimized codons is less than 70%, while for other amino acids, the percentage of substituted codons is greater than 70%. to achieve the total C-optimization percentage of at least 70% of all C-optimizable wild-type codons of the coding sequence.
[00245] [00245] —Preferably, in a C-optimized artificial nucleic acid molecule, preferably RNA, at least 50% of the wild-type C-optimizable codons for any given amino acid are replaced by C-optimized codons, for example , any modified C-enriched RNA (or other nucleic acid, in particular, RNA) preferably contains at least 50% C-optimized codons at C-optimizable wild-type codon positions encoding any of the aforementioned amino acids Ala, Cys, Asp, Phe, Gly, His, Ile, Leu, Asn, Pro, Arg, Ser, Thr, Val and Tyr, preferably at least 60%.
[00246] [00246] In this context, codons encoding amino acids, which are non-optimizable in cytosine content and which are, however, encoded by at least two codons, can be used without any further selection process. However, the codon of the wild-type sequence that encodes a tRNA that is relatively rare in the cell, for example, a human cell, can be exchanged for a codon that encodes a tRNA that is relatively frequent in the cell, both of which encode the same amino acid.
[00247] [00247] Therefore, the relatively rare codon GAA encoding Glu may be exchanged for the relatively frequent codon GAG encoding the same amino acid, and/or the relatively rare codon AAA encoding Lys may be exchanged for the relatively frequent codon AAG encoding the same amino acid , 'edition 870190141603, of 12/30/2019, p. 22181/22358 and/or the relatively rare codon CAA encoding GlIn may be switched to the relatively frequent codon CAG encoding the same amino acid.
[00248] [00248] In this context, the Met (AUG) and Trp (UGG) amino acids, which are encoded by only one codon each, remain unchanged. Stop codons are not optimized for cytosine content, however the relatively rare amber, ocher stop codons (UAA, UAG) can be swapped for the relatively frequent opal stop codon (UGA).
[00249] [00249] The single substitutions listed above can be used individually as well as in all possible combinations in order to optimize the cytosine content of the modified artificial nucleic acid molecule, preferably RNA, compared to the wild-type sequence.
[00250] [00250] — Therefore, the at least one coding sequence, as defined herein, may be altered compared to the coding sequence of the respective wild-type nucleic acid, preferably RNA, such that an amino acid - do is encoded by at least two or more codons, one of which comprises an additional cytosine, such codon may be exchanged for the C-optimized codon comprising an additional cytosine, wherein the amino acid is preferably unchanged compared to the wild-type sequence .
[00251] [00251] According to a preferred embodiment, the present invention provides a nucleic acid sequence, preferably RNA, more preferably mRNA, comprising at least one coding sequence comprising or consisting of any of the RNA sequences according to as SEQ ID NOs: 625 - 832, 76694 - 76716, 76960 - 76963, or a fragment 'edition 870190141603, of 12/30/2019, pg. 22182/22358 or variant of any of these sequences. Combined Modifications
[00252] [00252] The sequence modifications described in this document are particularly aimed at application to the coding sequences of artificial nucleic acid molecules, preferably RNAs, as described in this document. The modifications (including chemical modifications, lipid modifications and sequence modifications) may, if appropriate or necessary, be combined with each other in any combination, provided that the combined modifications do not interfere with each other, and preferably provided that the encoded antigenic fusion proteins preferentially retain their desired functionality or property, as described herein above.
[00253] [00253] — Preferably, artificial nucleic acids, preferably RNAs, according to the invention, comprise at least one coding sequence, as defined herein, wherein said coding sequence has been modified as described above, and encodes an antigenic fusion protein as defined herein.
[00254] [00254] According to preferred embodiments, the artificial nucleic acid molecule of the invention, preferably RNA, comprises at least one coding sequence, as defined herein, wherein (a) the G/C content of the at least a coding sequence of said artificial nucleic acid molecule, preferably RNA, is high compared to the G/C content of the corresponding coding sequence of the corresponding wild-type nucleic acid (preferably RNA), and/or (b ) wherein the C content of the at least one coding sequence of said artificial nucleic acid molecule, preferably RNA, is high compared to the C content of the coding sequence 870190141603, of 12/30/2019 , p. 22183/22358 corresponding wild-type nucleic acid (preferably RNA), and/or (c) wherein the codons in at least one coding sequence of said artificial nucleic acid molecule, preferably RNA, are adapted to the use of human codons, wherein the codon adaptation index (CAI) is preferably elevated or maximized in at least one coding sequence of said artificial nucleic acid molecule, preferably RNA, and wherein the amino acid sequence encoded by said artificial nucleic acid molecule, preferably RNA, is preferably not being modified compared to the amino acid sequence encoded by the corresponding wild-type nucleic acid (preferably RNA).
[00255] [00255] Preferably, the artificial nucleic acid molecule, preferably RNA, of the invention may comprise at least one coding region comprising or consisting of a nucleic acid sequence according to any one of SEQ ID NOs: 625 - 832, 76694 - 76716, 76960 - 76963, 833 - 1040, 76964 - 7696 - 7696, 2916, 2932, 2935, 76671 - 76693, 76956 - 76956 - 76956, 1249 - 1456, 76763 - 76785, 76972 - 76975, 1457 - 1664, 76786 - 76808, 76976 - 7697, 76809 - 7683, 76980 - 76983, 1873 - 2080, 76832 - 76854, 76984 - 76987, 2081 - 2288, 76855 - 76877, 76988 - 76991, 2289 - 2496, 76992 - 7699 - 7699, 76901 - 76923, 7699 - 76999, 2705 - 2912, 76924 - 76946, 77000 - 77003, 76947, 834 - 1248, 76740 - 76762, 76968 - 76971, 77004 - 77017, 77066, 76569, 76550 - 76568, 2936, 76494, 76475 - 76493, 77059 - 77061, 3295 - 3506, 3507 — 3718, 27946 — 52172, 76495 - 7651; 76570 - 76589, or a fragment, variant or derivative (preferably functional) of any of said sequences, preferably comprising or consisting of a nucleic acid sequence having 'edition 870190141603, of 12/30/2019, p. 22184/22358 at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85% , even more preferably at least 90% and more preferably at least 95% or even 97% sequence identity to any of said sequences. Chapter 5
[00256] [00256] According to preferred embodiments, artificial nucleic acid molecules, preferably RNAs, as defined in this document, may be modified by the addition of the so-called "cap 5" structure, which preferably stabilizes said nucleic acid molecule. artificial, preferably RNA, as described in this document.
[00257] [00257] Therefore, in preferred embodiments, the artificial nucleic acid, preferably RNA, of the invention may comprise a 5' CAP structure, preferably m7G (m7G(5')ppp(5')G), capO, cap1, cap2, a modified cap0 or modified cap1 structure (generated using an analog of cap as defined below).
[00258] [00258] “A "cap 5" is an entity, typically a modified nucleotide entity, that generally "caps" the 5' end of a mature mRNA. The 5' cap may typically be formed by a modified nucleotide, particularly a derivative of a guanine nucleotide. Preferably, the 5' cap is linked to the 5' terminus via a 5'-5'-triphosphate bond. The 5' cap may be methylated, for example m7GpppN, where N is the 5' terminal nucleotide of the nucleic acid carrying the 5' cap, typically the 5' end of an mRNA. m7GpppN is a 5' a cap structure, which naturally occurs in polymerase transcribed mRNA | and, therefore, is preferably not considered a modification comprised in a "modified" mRNA in this 'edition 870190141603, of 12/30/2019, p. 22185/22358 context. Therefore, a "modified" artificial nucleic acid molecule, preferably RNA, may comprise an m7GpppN as the 5' cap, but additionally said modified artificial nucleic acid molecule, preferably RNA, typically comprises at least one additional modification as defined herein. - to.
[00259] [00259] — Preferably, the 5' cap is added using a 5"-5"-triphosphate bond (also called m7GpppN). Other examples of 5' cap structures include glyceryl, inverted deoxy abasic residue (moiety), 4',5' methylene nucleotide, 1-(beta-D-erythrofuranosyl) nucleotide, 4'-thio nucleotide, carbocyclic nucleotide, nucleotide 1 ,5-anhydrohexitol, L-nucleotides, alpha-nucleotide, base-modified nucleotide, threo-pentofuranosyl nucleotide, 3',4'-dry acyclic nucleotide, 3,4-dihydroxybutyl acyclic nucleotide, nucleotide 3, 5 dihydroxypentyl acyclic, 3'-3"-inverted nucleotide portion, 3'-3"-inverted basic portion, 3'-2'-inverted nucleotide portion, 3'-2"-inverted basic portion, 1, 4-butanediol phosphate, 3'-phosphoramidate, hexyl phosphate, aminohexyl phosphate, 3'-phosphate, 3'-phosphorothioate, phosphorodithioate, or bridged or unbridged methiphosphonate moiety. These modified 5' cap structures are considered as at least a modification in this context.
[00260] [00260] Particularly preferred "modified" cap 5' structures are cap1 (ribose methylation of the adjacent m7G nucleotide), cap2 (additional ribose methylation of the 2nd nucleotide downstream of the m7G), cap3 (additional ribose methylation of the m7G). 3rd nucleotide downstream of m7G), cap4 (ribose methylation of 4th nucleotide downstream of m7G), ARCA (anti-reverse cap analog, modified ARCA (e.g., phosphothioate-modified ARCA), inosine, Ni-methyl-guanosine , 2-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine and 2-azido-guanosine.
[00261] [00261] In accordance with preferred embodiments of the present invention, the artificial nucleic acid molecule, in particular RNA, comprises a 5' cap structure selected from m7GpppN or cap1.
[00262] [00262] “A 5' cap structure (capO or cap1) can be formed in chemical RNA synthesis or in vitro RNA transcription (cotranscriptional capping) using cap analogs.
[00263] [00263] The term "cap analog", as used herein, will be recognized and understood by those skilled in the art and, for example, is intended to refer to a non-polymerizable dinucleotide that has cap functionality in that it facilitates translation or localization, and/or prevents degradation of a nucleic acid molecule, particularly an RNA molecule, when incorporated into the 5' end of the nucleic acid molecule. Non-polymerizable means that the cap analog will only be incorporated at the 5' terminus because it lacks a 5' triphosphate and therefore cannot be extended in the 3' direction by a template-dependent polymerase, particularly by template-dependent RNA polymerase. . Examples of cap analogs include, but are not limited to, a chemical structure selected from the group consisting of m7GpppG, m7GpppA, m7GpppC; unmethylated cap analogs (e.g., GpppG); dimethyl cap analog (e.g. m2,7GpppG), trimethyl cap analog (e.g. m2,2,7GpppG), dimethyl symmetric cap analogs (e.g. m7Gpppm76G) or anti-reverse cap analogs (e.g. ARCA; m7, 2'OmeGpppG, m7,2dGpppG, m7,3 OmeGpppG, m7,3dGpppG and their tetraphosphate derivatives). Other cap analogs have been previously described — (WO2008/016473, WOZ2008/157688, VWO2009/149253, WO2011/015347 and WO2013/059475). Other suitable cap analogues in this context are described in WO2017/066793, WO2017/066781, WO2017/066791, WOZ2017/066789, WO2017/053297, WO2017/066782, WO2018075827 and WO2017/0663797, where , of 12/30/2019, p. 22187/22358 disclosures regarding cap analogs are incorporated herein by reference.
[00264] [00264] In some embodiments, a modified cap1 structure is used using a cap dialog disclosed in WO2017/053297, WO2017/066793, WO2017/066781, WOZ2017/066791, WOZ2017/066789, WO2017/066782, WO2018075827 and WOZ2017/06. In particular, any cap structures derivable from the structure disclosed in claim 1-5 of WO2017/053297 may suitably be used to co-transcriptionally generate a modified cap1 structure. Furthermore, any cap structures derivable from the structure defined in claim 1 or claim 21 of WO2018/075827 may suitably be used to co-transcriptionally generate a modified cap1 structure.
[00265] [00265] In preferred embodiments, a 5' cap structure may suitably be added co-transcriptionally using cap analogs, as defined herein, in an in vitro RNA transcription reaction, as defined herein. Preferred cap analogs in the context of the invention are m7G(5')ppp(5')G (mM7G) or 3-O-Me-m7G(5')ppp(5')G. Other preferred cap analogs in the context of the invention are m7G(5')ppp(5')(2OMeA)pG or m7G(5')ppp(5') (2' OMeG)pG to co-transcriptionally generate cap1 structures. .
[00266] [00266] In other embodiments, the 5' cap structure is added via enzymatic capping using capping enzymes (eg, vaccinia virus capping enzymes and/or cap-dependent 2'-O methyltransferases) to generate cap-dependent structures. capO or cap1 or cap2. The 5' cap structure (capO or cap1) can be added using immobilized capping enzymes and/or cap-dependent 2'-O methyltransferases using methods and means disclosed in WO2016/
[00267] [00267] — Therefore, the RNA of the first aspect may comprise a 5' cap structure, preferably m7G (m7G(5')), m7G(5')ppp(5')(2nd/OMeA) or m7G( 5')ppp(5')(2' OMeG). Poly(A)
[00268] [00268] "According to other preferred embodiments, the artificial nucleic acid molecule, preferably RNA, of the invention may contain a poly(A) sequence.
[00269] [00269] "A "poly(A)" sequence, also called a "po-II(A) tail" or "3'-poly(A) tail", is typically understood as a sequence of adenosine nucleotides, for example from about 400 nucleotides of adenosine, for example from about 20 to about 400, preferably from about 50 to about 400, more preferably from about 50 to about 300, even more preferably - from about 50 to about 250, more preferably from about 60 to about 250 nucleotides of adenosine. As used herein, a poly(A) sequence may also comprise about 10 to 200 nucleotides of adenosine, preferably about 100 nucleotides of adenosine, more preferably about 40 to 80 nucleotides of adenosine, or even more preferably about 50 to 70 nucleotides of adenosine. A poly(A) sequence is typically located at the 3' end of an RNA, in particular, an mRNA.
[00270] [00270] — Preferably, the artificial nucleic acid molecule, preferably RNA, of the invention may contain at its 3' terminus a poly(A) tail of typically about 10 to 200 nucleotides of adenosine, preferably about 10 to 100 nucleotides of adenosine, more preferably about 40 to 80 nucleotides of adenosine or even more preferably about 50 to 70 nucleotides of adenosine.
[00271] [00271] - Preferably, the poly(A) sequence in the 870190141603, 12/30/2019, pg. 22189/22358 of the artificial nucleic, preferably RNA, of the invention may be derived from a DNA template by in vitro RNA transcription.
[00272] [00272] —Alternatively, the poly(A) sequence can also be obtained in vitro by common chemical synthesis methods, without necessarily being transcribed by a DNA progenitor.
[00273] [00273] In addition, poly(A) sequences or poly(A) tails can be generated by enzymatic polyadenylation of the artificial nucleic acid molecule, preferably RNA, of the invention using commercially available polyadenylation kits and corresponding known protocols. in the technique. "Polyadenylation" is typically understood as the addition of a poly(A) sequence to a nucleic acid molecule, such as an RNA molecule, e.g. aa premature mRNA. Polyadenylation can be induced by a so-called polyadenylation signal. This signal is preferably located within a nucleotide span at the 3' end of the mRNA to be polyadenylated.
[00274] [00274] A polyadenylation signal typically comprises a hexamer consisting of adenine and uracil/thymine nucleotides, preferably the hexamer sequence AAUAAA. Other sequences, preferably hexamer sequences, are also conceivable. Polyadenylation typically occurs during processing of a pre-mRNA (also called premature mRNA). Typically, RNA maturation (from pre-mRNA to mature mRNA) comprises a polyadenylation step.
[00275] [00275] — Accordingly, the artificial nucleic acid molecule, preferably RNA, of the invention may comprise a polyadenylation signal that imparts polyadenylation to an RNA (transcribed) by specific protein factors (e.g., factor of cleavage and polyadenylation specificity (CPSF), cleavage-stimulating factor (CstF), cleavage factors | and II (CF | and CF 11), poly(A) polymerase 'edition 870190141603, of 12/30/2019, page 22190/22358
[00276] [00276] In accordance with preferred embodiments, the artificial nucleic acid molecule, preferably RNA, of the invention may contain a poly(C) tail at the 3' terminus of typically about 10 to 200 cytosine nucleotides, preferably about from 10 to 100 nucleotides of cytosine, more preferably about 20 to 70 nucleotides of cytosine or even more preferably about 20 to 60 or even 10 to 40 nucleotides of cytosine. RTUs
[00277] [00277] According to preferred embodiments, the artificial nucleic acid molecule, preferably RNA, of the invention may comprise at least one 5"- and/or 3-UTR element. a nucleic acid sequence which is derived from the 5'- or 3-UTR of any naturally occurring gene or which is derived from a fragment, homolog or variant of the 5'- or 3-UTR of a gene. Preferably, 5"- or 3'-UTR elements may be heterologous to at least one coding sequence of said artificial nucleic acid molecule, preferably RNA. Although 5"- or 3-UTR elements are derived from ge While naturally occurring nes may be preferred, synthetically modified UTR elements may also be used in the context of the present invention. 3' UTR
[00278] [00278] The term "3'UTR element" typically refers to an 'Edition 870190141603, 12/30/2019, pg. 22191/22358 nucleic acid sequence, which comprises or consists of a nucleic acid sequence derived from a 3'UTR or a 3'UTR variant. Generally, the term "3'-UTR" refers to a part of a nucleic acid molecule that is located 3' (i.e., "downstream") of an open reading frame and that is not translated into protein. In the context of the present invention, a 3-UTR corresponds to a sequence that is located between the stop codon of the protein coding sequence, preferably immediately 3' to the stop codon of the protein coding sequence, and optionally, the poly(A) sequence of the artificial nucleic acid molecule, preferably RNA, of the invention.
[00279] [00279] The term "corresponds to" means that the 3”-UTR sequence may be an RNA sequence, such as in the MRNA sequence used to define the 3-UTR sequence, or a DNA sequence, which corresponds to such an RNA sequence. In the context of the present invention, the term "a 3'-UTR of a gene", such as "a 3'-UTR of a ribosomal protein gene", is the sequence that corresponds to the 3-UTR of the mature mMRNA derived from of this gene, that is, the mRNA obtained by transcription of the gene and maturation of pre-mature mRNA. The term "3-UTR of a gene" encompasses the DNA sequence and RNA sequence (sense and antisense and mature and immature) of the 3”-UTR.
[00280] [00280] A 3UTR element in the sense of the present invention may represent the 3UTR of an RNA, preferably an mRNA. Thus, in order to present the invention, preferably, a 3'UTR element can be the 3'UTR of an RNA, preferably of an mRNA, or it can be the transcriptional template for a 3'UTR of an RNA. Thus, a 3'UTR element preferably is a nucleic acid sequence that corresponds to the 3UTR of an RNA, preferably the 3UTR of an mRNA, such as an edition 870190141603, of 12/30/2019, p. 22192/22358
[00281] [00281] — Preferably, the at least one 3UTR element comprises or consists of a nucleic acid sequence derived from the 3UTR of a chordate gene, preferably a vertebrate gene, more preferably a mammalian gene, most preferably a human gene, or a 3UTR variant of a chordate gene, preferably a vertebrate gene, more preferably a mammalian gene, most preferably a human gene.
[00282] [00282] — Preferably, the artificial nucleic acid molecule, preferably RNA, of the invention comprises a 3'UTR element, which may be derivable from a gene that refers to an mMRNA with an improved half-life (which provides an mRNA stable), for example a 3'UTR element, as defined and described below. Preferably, the 3'UTR element is a nucleic acid sequence derived from a 3'UTR of a gene, which preferably encodes a stable mRNA, or a homologue, fragment or variant of said gene.
[00283] [00283] It may be particularly preferred that the 3'UTR element comprises or consists of a nucleic acid sequence, which is derived from a 3'UTR of a gene selected from the group consisting of an albumin gene, an alpha gene, -globin, a beta-globin gene, a tyrosine hydroxylase gene, a lipoxygenase gene, and an alpha collagen gene, such as the alpha 1(1) collagen gene, or a 3UTR variant of a gene selected from the group consisting of an albumin gene, an alpha-globin gene, a beta-globin gene, a tyrosine hydroxylase gene, a |lipoxygenase gene, an alpha collagen gene, such as a collagen gene 'edition 870190141603, of 12/30/2019, page 22193/22358 alpha 1(1) according to SEQ ID NO: 1369-1390 of patent application WOZ2013/143700, the disclosure of which is incorporated herein by reference, or of a homolog, a fragment or a variant thereof.
[00284] [00284] The term "a nucleic acid sequence that is derived from the 3UTR of a gene [...]" preferably refers to a nucleic acid sequence that is based on the 3UTR sequence of a gene [.. .] or a part thereof, such as in the 3UTR of an albumin gene, an alpha-globin gene, a beta-globin gene, a tyrosine hydroxylase gene, a lipoxygenase gene, an alpha collagen gene, such as an alpha 1(1) collagen gene, preferably from an albumin gene or a part thereof. This term includes sequences corresponding to the entire 3UTR variant sequence of a gene, i.e., the full-length 3UTR variant sequence of a gene, and sequences corresponding to a fragment of the 3UTR variant sequence of a gene. A fragment in this context preferably consists of a continuous stretch of nucleotides corresponding to the continuous stretch of nucleotides in the full-length 3UTR variant, which represents at least 20%, preferably at least 30%, more preferably at least 40%, most preferably at least 50 %, even more preferably at least 60%, even more preferably at least 70%, even more preferably at least 80%, and most preferably at least 90% of the full-length 3 UTR variant. Such a fragment of a variant, in the sense of the present invention, is preferably a functional fragment of a variant as described herein. 3' Albumin Derived UTRs
[00285] [00285] —Preferably, the 3UTR element can comprise or consist of a nucleic acid sequence that is derived from 'edition 870190141603, dated 12/30/2019, p. 22194/22358 of a 3'UTR of an albumin gene, preferably a vertebrate albumin gene, more preferably a mammalian albumin gene, most preferably a human albumin gene according to SEQ ID NO: 3073 or the corresponding RNA sequence (SEQ ID NO: 3074).
[00286] [00286] Human albumin 3'UTR SEQ ID NO: 3073: CATCACATTT —AAAAGCATCT CAGCCTACCA TGAGAATAAG AGAAAGAAAA — TGAAGATCAA AAGCTTATTC ATCTGTTITIT
[00287] [00287] The artificial nucleic acid molecule, preferably RNA, of the invention may comprise a 3-UTR element comprising a corresponding RNA sequence derived from the nucleic acids according to SEQ ID NOs: 1369-1390 of the application. WO2013/143700 or a fragment, homologue or variant thereof.
[00288] [00288] — Preferably, the 3UTR element may comprise the nucleic acid sequence derived from a fragment of the human albumin gene according to SEQ ID NO: 3075 or 3077: Albumin 7 3'UTR CATCACATTTAAAAAGCATCTCAGCCTACCATGAGAATAAGAGAAAG AAAATGAAGATCAATAGCTTATTCATCTCTTTTTCTITTITCGTTGGT GTAAAGCCAACACCCTGTCTAAAAAACATAAATTTCTTTAATCATTT
[00289] [00289] The 3UTR element of the artificial nucleic acid molecule 870190141603, 12/30/2019, p. 22195/22358 cial, preferably RNA, of the invention may preferably comprise or consist of an RNA sequence corresponding to the nucleic acid sequence according to SEQ ID NO: 3076 or
[00290] [00290] In other particularly preferred embodiments, the 3'UTR element comprises or consists of a nucleic acid sequence that is derived from a 3'UTR of an alpha-globin gene, preferably an alpha- or beta-globin gene. vertebrate globin, more preferably a mammalian alpha- or beta-globin gene, more preferably a human alpha- or beta-globin gene according to SEQ ID NO: 3065, 3067 or 3069 or the sequences of corresponding RNA: homo sapiens hemoglobin 3'-UTR, alpha 1 (HBA1)
[00291] [00291] For example, the 3UTR element may comprise or consist of the central alpha-complex binding portion of the 3UTR of an alpha-globin gene, such as a human alpha-globin gene, or a homolog, fragment, or a variant of an alpha-globin gene, preferably according to SEQ ID NO: 3071:
[00292] [00292] "Central alpha complex binding portion of the 3UTR of an alpha-globin ("muag") gene:
[00293] [00293] A "5-UTR" is typically understood to be a specific section of messenger RNA (mMRNA). It is located 5' of the mMRNA open reading frame. Typically, the 5-UTR begins with the transcriptional start site and ends one nucleotide before the open reading frame start codon. The 5-UTR may comprise elements to control gene expression, also called regulatory elements. Such regulatory elements may be, for example, ribosomal binding sites. The 5-UTR can be modified post-transcriptionally, for example, by the addition of a 5' cap. In the context of the present invention, a 5-UTR corresponds to the sequence of a mature mRNA, which is located between the 5' cap and the start codon. Preferably, the 5-UTR corresponds to the sequence, which extends from a nucleotide located in cap 3' to 5', preferably from the nucleotide located immediately in cap 3 to 5, to a nucleotide located in 5' cap. ' to the start codon of the protein coding sequence, preferably to the nucleotide located immediately 5' to the start codon of the protein coding sequence. The nucleotide located immediately 'etition 870190141603, of 12/30/2019, 22197/22358 in cap 3' to 5' of a mature MRNA typically corresponds to the transcription start site.The term "corresponds to" means that the 5'-UTR sequence can be an RNA sequence, such as as in the mMRNA sequence used to define the sequence of 5-UTR, or a DNA sequence, that corresponds to that RNA sequence. In the context of the present invention, the term "a 5"-UTR of a gene" is the sequence corresponding to the 5-UTR of the mature mRNA derived from that gene, i.e., the mRNA obtained by transcription of the gene and maturation of the mRNA. pre-mature. The term "5-UTR of a gene" encompasses the DNA sequence and the RNA sequence of the 5-UTR. By embodiments of the invention, such a 5-UTR may be provided at the 5' terminus for sequencing. - coding sequence. Its length is typically less than 500, 400, 300, 250 or less than 200 nucleotides. In other embodiments, its length can be in the range of at least 10, 20, 30 or 40, preferably up to 100 or 150 , nucleotides.
[00294] [00294] In the context of the present invention, 5 UTRs comprising or consisting of a nucleic acid sequence, which is derived from the SUTR of a TOP gene or which is derived from a fragment, homolog or variant of the SUTR of a TOP gene, may be particularly preferred.
[00295] [00295] The 5'-terminal oligopyrimidine (TOP) tract is typically an extension of pyrimidine nucleotides located in the 5'-terminal region of a nucleic acid molecule, such as the 5'-terminal region of certain mRNA molecules or the 5'-terminal region ' of a functional entity, for example, the transcribed region, of certain genes. The sequence starts with a cytidine, which usually corresponds to the transcriptional start site, and is followed by a stretch of usually about 3 to 30 nucleotides of pyrimidine. For example, the TOP can comprise 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 , 25, 26, 27, 28, 29, 30 or even more nu-'edition 870190141603, of 12/30/2019, p. 22198/22358 cleotids. The pyrimidine extension and thus the 5' TOP encloses a 5' nucleotide to the first purine nucleotide located downstream of the TOP. An mRNA containing a 5S'-terminal oligopyrimidine tract is often referred to as a "TOP MRNA". Therefore, the genes that provide these messenger RNAs are referred to as "TOP genes." TOP sequences, for example, have been found in genes and mRNAs that encode peptide elongation factors and ribosomal proteins.
[00296] [00296] TOP genes are typically characterized by the presence of a 5'terminal oligopyrimidine (TOP) tract. Furthermore, most TOP genes are characterized by translational regulation associated with growth. However, also TOP genes with tissue-specific translational regulation are known. As defined above, the SUTR of a TOP gene corresponds to the sequence of a 5UTR of a mature mRNA derived from a TOP gene, which preferentially extends from the nucleotide located in cap 3' to 5' to the nucleotide located in 5' cap. ' for the start codon. An S'UTR of a TOP gene typically does not comprise any start codons, preferably no upstream AUGs (UAUGs) or upstream open reading frames (uORFs). Thus, upstream AUGs and upstream open reading frames are typically understood as AUGs and open reading frames that occur 5' at the start codon (AUG) of the open reading frame that is to be translated. The S'UTRs of the TOP genes are generally very short. The lengths of the 5 UTRs of TOP genes can range from 20 nucleotides to 500 nucleotides, and are typically less than about 200 nucleotides, preferably less than about 150 nucleotides, more preferably less than about 100 nucleotides. - gods. Exemplary SUTRs of TOP genes in the sense of the present invention are nucleic acid sequences extending from 'edition 870190141603, 12/30/2019, p. 22199/22358 nucleotide at position 5 for the nucleotide located immediately 5' to the start code (e.g. ATG) in the sequences according to SEQ ID NOs: 1-1363 of patent application WOZ2013/143700, the disclosure of which is incorporated herein by reference. In this context, a particularly preferred fragment of a 5'UTR of a TOP gene is a 5'UTR of a TOP gene lacking the 5'TOP motif. The terms "S'UTR of a TOP gene" or "5-TOP UTR" preferably refer to the SUTR of a naturally occurring TOP gene.
[00297] [00297] In the context of the present invention, a "TOP motif" is a nucleic acid sequence that corresponds to a 5'TOP as defined above. Thus, a TOP motif in the context of the present invention is preferably an extension of pyrimidine nucleotides with a length of 3-30 nucleotides. Preferably, the TOP motif consists of at least 3 nucleotides of pyrimidine, preferably at least 4 nucleotides of pyrimidine, preferably at least 5 nucleotides of pyrimidine, more preferably at least 6 nucleotides, more preferably at least 7 nucleotides, more preferably at least 8 pyrimidine nucleotides, wherein the pyrimidine nucleotide extension preferably begins at its 5' end with a cytosine nucleotide. In TOP genes and TOP mRNAs, the TOP motif preferably starts at the 5' end with the transcription start site and ends a 5' nucleotide to the first purine residue in said gene or mRNA. A TOP motif in the sense of the present invention is preferably located at the 5' end of a sequence representing a 5'UTR, or at the 5' end of a sequence encoding a 5'UTR. Thus, preferably, a stretch of 3 or more pyrimidine nucleotides is termed a "TOP motif" in the sense of the present invention, if that stretch is located at the S-terminus of a respective sequence, such as the 'ethition molecule 870190141603, of 12/30/2019, page 22200/22358 artificial nucleic acid, the S5UTR element of the artificial nucleic acid molecule, or the nucleic acid sequence which is derived from the S'UTR of a TOP gene as described herein. In other words, a stretch of 3 or more nucleotides of pyrimidine, which is not located at the 5' end of an S'UTR or a SUTR element, but anywhere within a 5'UTR or a SUTR element. 5S'UTR, preferably not referred to as "TOP reason".
[00298] [00298] - Preferably, the 5UTR element of the artificial nucleic acid molecule, preferably RNA, of the invention may not comprise a TOP motif or a 5'TOP, as defined above.
[00299] [00299] The nucleic acid sequence of the 5UTR element, which is derived from a 5UTR of a TOP gene, may preferentially terminate at its 3' end with a nucleotide located at position 1, 2, 3, 4, 5, 6 , 7, 8, 9 or 10 upstream of the start codon (eg, A(U/T)G) of the gene or mRNA from which it is derived. For example, the 5UTR element may preferably not comprise any part of the protein coding sequence.
[00300] [00300] Therefore, preferably, the single amino acid coding part of the at least one artificial nucleic acid molecule, preferably RNA, can be provided by its coding region.
[00301] [00301] The nucleic acid sequence derived from the SUTR of a TOP bgene may preferably be derived from a eukaryotic TOP gene, preferably a plant or animal TOP gene, more preferably a chordate TOP gene, even more preferably a vertebrate TOP gene, more preferably a mammalian TOP gene, such as a human TOP gene.
[00302] [00302] For example, the 5'UTR element can preferably be selected from 5-UTR elements that comprise or consist of 'edition 870190141603, of 12/30/2019, p. 22201/22358 has in a nucleic acid sequence, which is derived from a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-1363, SEQ ID NO: 1395, SEQ ID NO: 1421 and SEQ ID NO: 1422 of patent application WO2013/143700, the disclosure of which is incorporated herein by reference, of the homologues of SEQ ID NOs: 1-1363, SEQ ID NO: 1395, SEQ ID NO: 1421 and SEQ ID NO: 1422 from patent application WO2013/143700, a variant thereof, or preferably a corresponding RNA sequence. The term "homologues of SEQ ID NOs: 1-1363, SEQ ID NO: 1395, SEQ ID NO: 1421 and SEQ ID NO: 1422 of patent application WO2013/143700" refers to sequences from species other than of homo sapiens, which are homologous to the sequences according to SEQ ID NOs: 1-1363, SEQ ID NO: 1395, SEQ ID NO: 1421 and SEQ ID NO: 1422 of patent application WO2013/143700.
[00303] [00303] Preferably, the 5UTR element of the artificial nucleic acid molecule, preferably RNA, of the invention may comprise or consist of a nucleic acid sequence, which is derived from a nucleic acid sequence that extends from the nucleotide position 5 (that is, the nucleotide that is located at position 5 in the sequence) to the nucleotide position immediately 5' to the start codon (located at the 3' end of the sequences), for example, the position of nucleotide immediately 5' to the ATG sequence, of a nucleic acid sequence selected from SEQ ID NOs: 1-1363, SEQ ID NO: 1395, SEQ ID NO: 1421, and SEQ ID NO: 1422 from patent application WO2013 /143700, from the homologues of SEQ ID NOs: 1 -1363, SEQ ID NO: 1395, SEQ ID NO: 1421 and SEQ ID NO: 1422 from patent application WO2013/143700 of a variant thereof, or a sequence of corresponding RNA. It is particularly preferred that the 5'UTR element is derived from a nucleic acid sequence that extends from nucleation position 870190141603, 12/30/2019, pg. 22202/22358 cleotide immediately 3' to 5' TOP to the nucleotide position immediately 5' to the start codon (located at the 3' end of the sequences), for example, the nucleotide position immediately 5' to the ATG sequence, from a nucleic acid sequence selected from SEQ ID NOs: 1-1363, SEQ ID NOs: 1395, SEQ ID NOs: 1421 and SEQ ID NO: 1422 from patent application WO2013/143700, homologs of SEQ ID NOs: 1 -1363, SEQ ID NO: 1395, SEQ ID NO: 1421 and SEQ ID NO: 1422 from patent application WO2013/143700, a variant thereof, or a corresponding RNA sequence.
[00304] [00304] It may be particularly preferred that the S'UTR element includes or consists of a nucleic acid sequence, which is derived from a SUTR of a TOP gene encoding a ribosomal protein or from a variant of a 5'UTR of a gene TOP encoding a ribosomal protein. For example, the SUTR element may preferably comprise or consist of a nucleic acid sequence, which is derived from a 5'UTR of a nucleic acid sequence according to any one of SEQ ID NOs: 67, 170, 193, 244 , 259, 554, 650, 675, 700, 721, 913, 1016, 1063, 1120, 1138 and 1284-1360 of patent application WO2013/143700 , a corresponding RNA sequence, a homologue thereof or a of the same as described in this document, preferably without the 5' TOP motif. As described above, a sequence that extends from position 5 to the nucleotide immediately 5' to the ATG (which is located at the 3' end of the sequences) corresponds to the S'UTR of the aforementioned sequences.
[00305] [00305] The artificial nucleic acid molecule, preferably RNA, of the invention may thus comprise a 5'UTR element, which comprises or consists of a nucleic acid sequence, which is derived from the SUTR of a vertebrate TOP gene, such as an 'edition 870190141603, of 12/30/2019, pg. 22203/22358 mammal, for example, a human TOP gene, selected from RPSA, RPS2, RPS3, RPS3A, RPS4, RPS5, RPS6, RPS7, RPS8, RPS9, RPS10, RPS11, RPS12, RPS13, RPS14, RPS15, RPS15A, RPS16 , RPS17, RPS18, RPS19, RPS20, RPS21, RPS23, RPS24, RPS25, RPS26, RPS27, RPS27A, RPS28, RPS29, RPS30, RPL3, RPLA, RPL5, RPL6, RPL7, RPL7A, RPL8, RPL9, RPL10, RPLIOA, RPL11 , RPL12, RPL13, RPL1I3A, RPL14, RPL15, RPL17, RPL18, RPL18A, RPL19, RPL21, RPL22, RPL23, RPL23A, RPL24, RPL26, RPL27, RPL27A, RPL28, RPL29, RPL30, RPL31, RPL32, RPL34, RPL355 , RPL36, RPL36A, RPL37, RPL37A, RPL38, RPL39, RPLA0O, RPL41, RPLPO, RPLP1, RPLP2, RPLP3, RPLPO, RPLP1, RPLP 2, EEF1A1, EEF1IB2, EEFID, EEFIG, EEF2, EIF3E, EIF3F, EIF3H, EIF2S3 , EIF3C, EIF3K, EIF3EIP, EIF4A2, PABPC1, HNRNPA1, TPT1, TUBB1, UBA52, NPM1, ATP5G2, GNB2L1, NME2, UQCRB, or of a homolog or variant thereof, wherein preferably the SUTR element does not comprise a TOP motif or the 5'TOP of said genes, and where optionally the element 5UTR starts at its 5' end with a nucleotide located at position 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 downstream of the 5'-terminal oligopyrimidine (TOP) tract and where optionally the 5'UTR element that is derived from a 5UTR of a TOP gene terminates at its 3' end with a nucleotide located at position 1, 2, 3, 4, 5, 6,7, 8, 90u 10 upstream of the codon of start (A(U/T)G) of the gene from which it is derived.
[00306] [00306] — Preferably, the SUTR element may comprise or consist of a nucleic acid sequence, which is derived from the S'UTR of a Large 32 ribosomal protein gene (RPL32), a Large 35 ribosomal protein gene (RPL35) , a Large 21 ribosomal protein gene (RPL21), an ATP synthase, H+ transport, F1 mitochondrial complex, alpha 1 subunit, heart muscle gene (ATPS5A1), a hydroxysteroid (17-beta) dehydrogenase 4 gene (HSD17B4) , a gene 'etition 870190141603, of 12/30/2019, p. 22204/22358 androgen-induced 1 (AIG1), cytochrome c oxidase Vic subunit gene (COX6C) or an N-acylsphingosine amidohydrolase (acid ceramidase) gene (ASAH1) or a variant thereof, preferably a Large 32 vertebrate ribosomal protein gene (RPL32), a Large 35 vertebrate ribosomal protein gene (RPL35), a Large 21 vertebrate ribosomal protein gene (RPL21), an ATP synthase from vertebrates, H+ transport, mitochondrial F1 complex, alpha 1 subunit, heart muscle gene (ATPS5A1), a vertebrate hydroxysteroid (17-beta) dehydrogenase 4 (HSD17B4), a vertebrate androgen-induced gene 1 (AIG1) ), a vertebrate cytochrome c oxidase Vlc subunit gene (COX6C), or a vertebrate N-acylesphingosine amidohydrolase (acid ceramidase) 1 (ASAH1) gene or a variant thereof, most preferably a Large 32 gene. of mammalian ribosomal protein (RPL32), a Large 35 ribosomal protein gene (RPL35), a mammalian ribosomal protein Large 21 gene (RPL21), a mammalian ATP synthase, H+ transport, mitochondrial F1 complex, alpha 1 subunit, heart muscle gene (ATP5A1), a gene mammalian hydroxysteroid (17-beta) dehydrogenase 4 (HSD17B4), a mammalian androgen-induced gene 1 (AIG1), a mammalian cytochrome c oxidase Vic subunit gene (COX6C), or an N- mammalian acylsphingosine amidohydrolase (acid ceramidase) 1 (ASAH1) or a variant thereof, more preferably from a human ribosomal protein Large 32 gene (RPL32), a human ribosomal protein Large 35 gene (RPL35), a human ribosomal protein Large 21 gene human ribosomal protein (RPL21), a human ATP synthase, H+ transport, F1 mitochondrial complex, alpha 1 subunit, heart muscle gene (ATP5A1), human hydroxysteroid (17-beta) dehydrogenase 4 gene (HSD17B4), an induced gene by human androgen 1 (AIG1), a gene of the 'etiology 870190141603 subunit, of 12/30/2019, page 22205/22358
[00307] [00307] Preferably, the artificial nucleic acid molecule, preferably RNA, of the invention may comprise a 5UTR element comprising or consisting of a nucleic acid sequence which is derived from a 5UTR of a TOP gene encoding an alpha subunit of ATP mitochondrial synthase or a homologue or variant of a 5 UTR of a TOP gene encoding a mitochondrial ATP synthase alpha subunit, preferably without the 5'TOP motif.
[00308] [00308] In this context, the 5'UTR element preferably comprises or consists of a nucleic acid sequence that is derived from the 5 UTR of a mitochondrial ATP synthase alpha subunit gene, preferably from an ATP alpha subunit gene vertebrate mitochondrial synthase (ATP5A1), more preferably a mammalian mitochondrial ATP synthase alpha subunit gene (ATP5A1), more preferably a human mitochondrial ATP synthase alpha subunit gene (ATP5A1), or a variant of the S'UTR from a mitochondrial ATP synthase alpha subunit gene, preferably from a vertebrate mitochondrial ATP synthase alpha subunit gene (ATP5A1), more preferably a mammalian mitochondrial ATP synthase alpha subunit gene (ATP5A1), most preferably a human mitochondrial ATP synthase alpha subunit gene (ATP5A1), in which preferably the 5 UTR element does not comprise the 5 TOP of said gene.
[00309] [00309] — Therefore, in a particularly preferred embodiment, the SUTR element comprises or consists of a section 870190141603, dated 12/30/2019, p. 22206/22358 nucleic acid sequence, which has an identity of at least about 40%, preferably at least about 50%, preferably at least about 60%, preferably at least about 70%, more preferably at least about 70% about 80%, more preferably at least about 90%, even more preferably at least about 95%, even more preferably at least about 99% with the nucleic acid sequence according to SEQ ID NO: 3063 (5-UTR of ATP5A1 without the 5' terminal oligopyrimidine tract: GCGGCTCGGCCATTTTGTCCCAGTCAGTCCG-GAGGCTGCGGCTGCAGAAGTACCGCCTGCGGAGTAACTGCAAAG; corresponding to SEQ ID NO: 1414 of patent application WO2013/143700) or preferably with a corresponding RNA sequence, or wherein the at least one 5UTR element comprises or consists of a fragment of a nucleic acid sequence that has an identity of at least about 40%, preferably at least about 50%, preferably at least about 60%, preferably at least about 70%, more preferably at least about 80%, more preferably at least about 90%, even more preferably at least about 95%, even more preferably at least about 99% with the nucleic acid sequence according to SEQ ID NO: 3063 or, more preferably, with a corresponding RNA sequence, wherein, preferably, the fragment is as described above, i.e., being a continuous extension of nucleotides representing at least 20% etc. of the full-length SUTR.
[00310] [00310] Preferably, the artificial nucleic acid molecule, preferably RNA, of the invention may comprise a 5UTR element that comprises or consists of a nucleic acid sequence, which is derived from a 5UTR of a TOP gene encoding a Large ribosomal protein ( RPL) or a homolog or variant of a 5S'UTR of a TOP gene encoding a Large ribosomal protein (RPL). For example, the 5UTR element comprises or consists of a nucleic acid sequence, which is derived from an S'UTR of a nucleic acid sequence according to any one of SEQ ID NOs: 67, 259, 1284-1318, 1344 , 1346, 1348-1354, 1357, 1358, 1421 and 1422 of patent application WO2013/143700 , a corresponding RNA sequence, a homologue thereof, or a variant thereof as described herein, preferably without motif 5 TOP.
[00311] [00311] In this context, the SUTR element may preferably comprise or consist of a nucleic acid sequence that is derived from the SUTR of a Large 32 ribosomal protein gene, preferably a Large 32 vertebrate ribosomal protein gene (L32), more preferably from a Large 32 mammalian ribosomal protein gene (L32), more preferably from a Large 32 human ribosomal protein gene (L32), or from a SUTR variant of a Large 32 protein gene ribosomal protein, preferably from a Large 32 vertebrate ribosomal protein (L32) gene, more preferably from a Large 32 mammalian ribosomal protein (L32) gene, most preferably from a Large 32 human ribosomal protein gene (L32) ), wherein preferably the 5'UTR element does not comprise the 5'TOP of said gene.
[00312] [00312] Therefore, the SUTR element can preferably comprise or consist of a nucleic acid sequence, 'edition 870190141603, of 12/30/2019, p. 22208/22358 which has an identity of at least about 40%, preferably at least about 50%, preferably at least about 60%, preferably at least about 70%, more preferably at least about 80 %, more preferably at least about 90%, even more preferably at least about 95%, even more preferably at least about 99% for the nucleic acid sequence according to SEQ ID NO: 3061 (5" - Human Large 32 ribosomal protein UTR lacking the 5' terminal oligopyrimidine tract: GGCGCTGCCTACGGAGGTGGCAGCCATCTC CTTCTCGGCATC; corresponding to SEQ ID NO: 1368 of patent application WO2013/143700) or preferably to an RNA sequence corresponding to, or in which the at least one SUTR element comprises or consists of a fragment of a nucleic acid sequence that has an identity of at least about 40%, preferably at least about 50%, preferably at least about 60%, preferably at least about 60%. preferably at least about 70%, more preferably at least about 80%, more preferably at least about 90%, even more preferably at least about 95%, even more preferably at least about 99% with the sequence of nucleic acid according to SEQ ID NO: 3061 or more preferably with a corresponding RNA sequence, wherein preferably the fragment is as described above, i.e. being a continuous stretch of nucleotides representing at least 20% etc. of the full-length SUTR.
[00313] [00313] According to preferred embodiments, the artificial nucleic acid molecule, preferably RNA, of the invention comprises a histone stem-loop structure/sequence.
[00314] [00314] Such histone stem-loop sequences are preferably selected from histone stem-loop sequences as disclosed in WO 2012/019780, the description of which is incorporated herein by reference.
[00315] [00315] A histone stem-loop sequence suitable for use within the present invention is preferably selected from at least one of the following Formulas (11) or (Ill): formula (II) (Structure sequence of stem-loop without stem boundary elements): [No2GN;3.6] INo4(U/T)No4] [N3.5CNo.2]
[00316] [00316] According to another preferred embodiment, the artificial nucleic acid molecule, preferably RNA, of the invention may comprise at least one histone stem-loop sequence according to at least one of the following formulas (lla) or (lla) : formula (lla) (stem-loop structure sequence without stem |imimitrophes elements): 'edition 870190141603, of 12/30/2019, p. 22212/22358
[00317] [00317] According to an even more particularly preferred embodiment, the artificial nucleic acid molecule, preferably RNA, of the invention may comprise at least one histone stem-loop sequence according to at least one of the following formulas (1Ib ) or (Illb): formula (IIb) (stem-loop structure sequence without stem |immitrophe elements) [N1GNA4] [N2(U/D)N1] [NACN1]
[00318] A particularly preferred histone stem-loop sequence is the sequence CAAAGGCTCTTTTCAGAGCCACCA (SEQ ID NO: 3079) or, more preferably, the corresponding RNA sequence CAAAGGCUCUUUUCAGAGCCACCA (SEQ ID NO: 3080). The. Constructs
[00319] [00319] The artificial nucleic acid molecule, preferably RNA, of the invention, which comprises at least one coding sequence as defined herein, preferably comprises at least one 5' UTR and/or at least one 3' UTR, as described herein, and optionally at least one histone stem-loop structure.
[00320] [00320] The A3 UTR of the artificial nucleic acid molecule, preferably RNA, of the invention (or any other nucleic acid, in particular RNA, as defined herein) may further comprise a poly(A) and/or poly(C) as defined in this document. The single elements of the 3' UTR may occur therein in any order from 5' to 3' along the sequence of the artificial nucleic acid molecule, preferably RNA, of the invention.
[00321] [00321] In addition, other elements as described in this document may also be contained, such as a stabilization sequence as defined herein (e.g. derived from the UTR of a globin gene), IRES sequences etc. Each of the elements may also be repeated in the artificial nucleic acid molecule, preferably RNA, of the invention at least once (particularly in di- or multicistronic constructs), for example twice or more. As an example, single elements may be present in the artificial nucleic acid molecule, preferably RNA, of the invention in the following order: 5'-coding sequence-Stem structure-Histone loop-Poly(A) sequence /(C)-3'; or 'edition 870190141603, of 12/30/2019, p. 22214/22358
[00322] [00322] According to other embodiments, the artificial nucleic acid molecule, preferably RNA, preferably further comprises at least one of the following structural elements: a histone stem-loop structure, preferably a histone stem-loop in its 3' region untranslated; a 5th cap structure; a poly-A tail; or a poly(C) sequence.
[00323] [00323] "According to some embodiments, in addition to the (poly-)peptides or proteins described herein, another peptide or protein is encoded by at least one coding sequence, as defined herein, wherein the other peptide or protein is preferably no histone protein, no reporter protein (e.g. Luciferase, GFP and their variants (such as eGFP, RFP or BFP), and/or no markers or sealing proteins, including alpha-globin, galactokinase and Xanthine:Guanine phosphoribosyl transferase (GPT), hypoxanthine-guanine phosphoribosyltransferase (HGPRT), beta-ethion 870190141603, 12/30/2019, page 22215/22358 galactosidase, galactokinase, alkaline phosphatase, secreted embryonic alkaline phosphatase (SEAP) ) or a resistance gene (such as a neomycin, puromycin, hygromycin, and zeocin resistance gene.) In preferred embodiments, the artificial nucleic acid molecule, preferably RNA, does not encode a reporter gene. er or a marker gene. In preferred embodiments, the artificial nucleic acid molecule, preferably RNA, does not encode luciferase. In other embodiments, the artificial nucleic acid molecule, preferably RNA, does not encode GFP or a variant thereof.
[00324] [00324] Specifically, artificial nucleic acid molecules, in particular RNAs, according to the invention, may preferably comprise in the 5' to 3' direction, the following elements: a) a 5' cap structure, preferably m7GpppN or Cap1 b) a 5-UTR element, which comprises or consists of a nucleic acid sequence, which is derived from a 5-UTR, as defined herein, preferably comprising a nucleic acid sequence corresponding to the nucleic acid sequence according to SEQ ID NO: 3061, 3063, or a homologue, fragment or variant thereof; Cc) at least one coding sequence as defined herein; d) a 3-UTR element, which comprises or consists of a nucleic acid sequence, which is derived from a 3-UTR, as defined herein, preferably comprising a nucleic acid sequence corresponding to the nucleic acid sequence of according to SEQ ID NO: 3065, 3067, 3069, 3071, 3073, 3075, 3077, or a homologue, a fragment or a variant thereof, e) optionally a poly(A) tail, preferably 'edition 870190141603, of 30 /12/2019, pg. 22216/22358 consisting of 10 to 1000, 10 to 500, 10 to 300 10 to 200, 10 to 100, 40 to 80 or 50 to 70 nucleotides of adenosine, f) optionally a poly(C) tail, preferably consisting of 10 to 200, 10 to 100, 20 to 70, 20 to 60 or 10 to 40 cytosine nucleotides, and g) optionally the histone stem-loop structure. Complexation
[00325] [00325] In accordance with some embodiments of the present invention, the artificial nucleic acid molecule, preferably RNA, of the invention, and/or any other nucleic acid disclosed herein (e.g., immunostimulatory nucleic acids) can be provided. in a "naked" form, i.e. without association with any other vehicle, transfection agent or complexing to increase the transfection efficiency and/or the immunostimulatory properties of said artificial nucleic acid molecule, preferably RNA, or any other acid nucleic.
[00326] [00326] In accordance with other preferred embodiments, the artificial nucleic acid molecule, preferably RNA, of the invention, and/or any other nucleic acid disclosed herein (e.g., immunostimulatory nucleic acids) is/are provided in a form complexed. Thus, the at least one artificial nucleic acid molecule, preferably RNA, or any other nucleic acid disclosed herein may be associated with a suitable vehicle, transfection agent or complexing to increase transfection efficiency and/or the immunostimulatory properties of said artificial nucleic acid molecule, preferably RNA, or said other nucleic acid.
[00327] [00327] According to preferred embodiments, said artificial nucleic acid molecule, preferably RNA, and/or said other nucleic acid is/are complexed or associated with one or more , p. 22217/22358 (poly-)cationic compounds, preferably with (poly-)cationic polymers, (poly-)cationic peptides or proteins, e.g. protamine, (poly-)cationic polysaccharides and/or lipids [(poly-) cationic]. In this context, the terms "complexed" or "associated" refer to the essentially stable combination of said artificial nucleic acid molecule, preferably RNA, or said other nucleic acid, with one or more of the compounds mentioned above in complexes or larger sets without covalent bonding. lipids
[00328] [00328] “According to preferred embodiments, the artificial nucleic acid molecule, preferably RNA, or any other nucleic acid disclosed herein, is complexed with one or more lipids, thus forming lipid nanoparticles, lipoplexes and/or pre - preferably liposomes.
[00329] [00329] Therefore, the artificial nucleic acid molecule, preferably RNA, of the invention and/or any other nucleic acid disclosed herein may be provided in the form of a lipid-based formulation, in particular, in the form of liposomes. , lipoplexes, and/or lipid nanoparticles comprising said artificial nucleic acid molecule, preferably RNA, and/or said other nucleic acid disclosed herein.
[00330] [00330] The term "lipid nanoparticle", also referred to as "LNP", is not restricted to any particular morphology and includes any morphology generated when a cationic lipid and optionally one or more additional lipids are combined, for example, in an aqueous environment and/or in the presence of RNA. For example, a liposome, a lipid complex, a lipoplex and the like are within the scope of a lipid nanoparticle (LNP). Lipid Nanoparticles
[00331] [00331] The artificial nucleic acid molecule, preferably 'edition 870190141603, of 12/30/2019, p. 22218/22358
[00332] [00332] — Preferably, the lipid nanoparticles (LNPs) comprise: (a) at least one artificial nucleic acid molecule, preferably RNA, of the invention or any other nucleic acid disclosed herein, (b) a lipid cationic, (c) an aggregation reducing agent (such as a polyethylene glycol (PEG) lipid or PEG-modified lipid), (d) optionally a non-cationic lipid (such as a neutral lipid), and (e) optionally, a sterol. In particular, LNPs may comprise, in addition to at least one artificial nucleic acid molecule, preferably RNA, of the invention and/or any other nucleic acid disclosed herein (i) at least one cationic lipid; (ii) a neutral lipid; (iii) a sterol, for example cholesterol; and (iv) a PEG lipid, in a molar ratio of about 20-60% cationic lipid: 5-25% neutral lipid: 25-55% sterol; 0.5-15% PEG lipid.
[00333] [00333] The artificial nucleic acid molecule, preferably RNA, of the invention and/or any other nucleic acid disclosed herein may be formulated in a lipid aminoalcohol. aminoalcohol lipids that can be used in the present invention can be prepared by the methods described in US Patent No.
[00334] [00334] LNPs typically comprise a cationic lipid and one or more excipients selected from neutral lipids, charged lipids, steroids, and polymer-conjugated lipids (eg, PEGylated lipid). RNA can be encapsulated in the lipid portion of an LNP or an aqueous space enveloped by part or all of the etiology portion 870190141603, dated 12/30/2019, p. 22219/22358 LNP lipid. The RNA or a portion thereof can also be associated and complexed with an LNP. An LNP may comprise any lipid capable of forming a particle with which the nucleic acids are linked, or in which the one or more nucleic acids are encapsulated. Preferably, the LNP comprising nucleic acids comprises one or more cationic lipids, and one or more stabilizing lipids. Stabilizing lipids include neutral lipids and PEGylated lipids.
[00335] [00335] The cationic lipid of an LNP may be cationizable, i.e. become protonated as the pH is reduced below the pK of the ionizable group of the lipid, but is progressively more neutral at higher pH values . At pH values below the pK, the lipid is then able to associate with negatively charged nucleic acids. In certain embodiments, the cationic lipid comprises a zwitterionic lipid that assumes a positive charge on decreasing pH. (i) Cationic Lipids
[00336] [00336] LNPs may include any cationic lipid suitable to form a lipid nanoparticle. Preferably, the cationic lipid carries a net positive charge at about physiological pH.
[00337] [00337] The cationic lipid may be an aminolipid, as used herein, the term "aminolipid" is intended to include those lipids having one or two fatty acid or fatty acid chains and an amino head group (including an alkylamino or dialkylamino group). - no) which can be protonated to form a cationic lipid at physiological pH.
[00338] [00338] The cationic lipid can be, for example, N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N-N-distearyl-N,N-dimethylammonium bromide (DDAB), 1,2 -dioleoyltrimethyl ammonium propane 'ethition 870190141603, of 12/30/2019, pg. 22220/22358
[00339] [00339] — Other cationic lipids include, but are not limited to, N,N-distearyl-N,N-dimethylammonium bromide (DDAB), 3P-(N-(N'N'-dimethylaminoethane)-carbamoyl)cholesterol (DC -Chol), N-(1-(2,3-dioleyloxy)propyl)-N-2-(spermine-carboxamido)ethyl)-N-N-dimethylammonium trifluoracetate (DOSPA;), dioctadecylamidoglycyl carboxyspermine (DOGS), 1,2-dileoyl-sn-3-phosphoethanolamine (DOPE), 1,2-dioleoyl-3-dimethylammonium propane (DODAP), N-(1,2-dimyristyloxyprop-3-yl)-N,N bromide -dimethyl-N-hydroxyethyl ammonium (DMRIE), and 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (XTC). Additionally, commercial preparations of cationic lipids can be used, such as, for example, LIPOFECTIN (including DOTMA and DOPE, available from GIBCO/BRL), and LIPOFECTAMINE (comprising DOSPA and DOPE, available from GIBCO/BRL).
[00340] [00340] Other suitable cationic lipids are disclosed in International Publication Nos. WO 09/086558 , WO 09/127060 , WO 10/048536 , WO 10/054406 , WO 10/088537 , WO 10/129709 , and WO 2011/153493 ; Patent Publications Nos. 2011/0256175, 2012/0128760, and 2012/0027803; US Patent Nos. 8,158,601; and Love et al, PNAS, 107(5), 1864-69, 2010.
[00341] [00341] In some embodiments, the lipid is selected from the group consisting of 98N12-5, C12-200 and ckk-E12.
[00342] [00342] In other embodiments, ionizable lipids can also be the compounds as disclosed in WOZ2015/074085A1 (i.e., ATX-001 to ATX-032 or the compounds as specified in claims 1-26), US Application Nos. 61/905,724 and 15/614,499 or US Patent Nos. 9,593,077 and 9,567,296 are incorporated herein by reference in their entirety.
[00343] [00343] In such a context, any lipid derived from the Generic Formula (LNP-I) 'edition 870190141603, of 12/30/2019, p. 22222/22358
[00344] [00344] In other embodiments, suitable cationic lipids may also be the compounds as disclosed in WO2017/117530A1 (i.e., lipids 13, 14, 15, 16, 17, 18, 19, 20, or the compounds as specified in the claims), incorporated herein by reference in their entirety.
[00345] [00345] In such a context, any lipid derived from the Generic Formula (LNP-II) o is Sh À a A N f LU Ra O xt n where 'edition 870190141603, of 12/30/2019, p. 22223/22358
[00346] [00346] In preferred embodiments, a lipid may be used derived from Formula (LNP-II), wherein, X is a bond, alkylene, linear or branched alkenylene, or arene or heteroarene monocyclic, bicyclic or tricyclic; Y is a monocyclic, bicyclic or tricyclic arene or heteroarene; Z is S or O; L is linear or branched alkylene of 1 to 6 carbons; R3 and Ra are independently linear or branched alkyl of 1 to 6 carbons; R1 and R2 are independently linear or branched alkyl or alkenyl of 1 to 20 carbons; r 0 to 6; em, n,p, and q are independently 1 to 18; or a pharmaceutically acceptable salt thereof may suitably be used.
[00347] [00347] In preferred embodiments, ionizable lipids may also be selected from the lipid compounds disclosed in PCT Application PCT/EP2017/077517 (i.e., lipid compounds derived from Formula I, II, and III of POCT/EP2017/077517, or lipid compounds as specified in claims 1 to 12 of PCT/EP2017/'edition 870190141603, of 12/30/2019, page 22224/22358
[00348] [00348] In particularly preferred embodiments of the second aspect, a suitable lipid may be a cationic lipid according to formula (LNP-III) Ros
[00349] [00349] The Formula (LNP-III) is further defined, where: one of L' or L is -O(C=O)-, -(C=0)O-, -C(=O)-, -O-, -S(O).-, -SS-, -C(=O)S -, SC(=O)-, -NRºC(=O)-, -C(=O)NRº-, -NRºC(=O)NRº-, -OC(=O)NRº- or -NRºC(=0) O-, and the other of L' or Lº is -O(C=O)-, - (C=0)O-, -C(=O)-, -O-, -S(O)x-, -SS-, -C(=O)S-, SC(=O)-, -NRºC(=O)-, -C(=O)NRº-, -NRºC(=O)NRº-, -OC(= O)NRº- or -NRºC(=0)O- or a direct bond; G' and G are each independently C1-C12 alkylene or unsubstituted C1-C12 alkenylene; G* is C1-C24 alkylene, C1-C24 alkenylene, C3-Csa cycloalkylene, C3-C;s cycloalkenylene; 'edition 870190141603, of 12/30/2019, page 22225/22358
[00350] [00350] In some of the above modalities of the Formula (LNP-III), the lipid has one of the following structures (LNP-IIIA) or (LNP-IIIB): Rê Rô Rà Rô ““ Y RE Ser Se (LNP-INIA) ; RO Ser Se and (LNP-IIIB) wherein: A is a 3 to 8 membered cycloalkyl or cycloalkylene ring; R6 is, at each occurrence, independently H, OH or C1-Caa alkyl; n is an integer ranging from 1 to 15.
[00351] [00351] In some of the above embodiments of the Formula (LNP-III), the lipid has structure (LNP-IIIA), and in other embodiments, the lipid has structure (LNP-IIIB).
[00352] [00352] In other forms of Formula (LNP-III), the lipid has one of the following structures (LNP-IIIC) or (LNP-IIID): Rê Rô Rà Rô h ' ) 1 Ai 2 1 N BZ ROO OOE e ( LNP-MIC); ROO SR (LNP-NID) where y and z are each independently integers ranging from 1 to 12.
[00353] [00353] In any of the above embodiments of Formula (LNP-III), one of L' or L is -O(C=O)-. For example, in some modalities, each of L' and L are -O(C=O)-. In some modalities, edition 870190141603, of 12/30/2019, p. 22226/22358 close to any of the above, L' and L are each independently -(C=O)O- or -O(C=0O)-. For example, in some modalities, each of L' and L is -(C=0)O-.
[00354] [00354] In preferred embodiments, the LNP cationic lipid is a compound of Formula (LNP-IlI), wherein: L' and L are each independently -O(C=O)- or (C=O)-O-; G is C1-C24 alkylene or C1-C24 alkenylene; and Rº is H or OR”.
[00355] [00355] In some different embodiments of Formula (LNP-II!), the lipid has one of the following structures (LNP-IIIE) or (LNP-IIIF): 3 R Nos | 1 2 R NE er me o O —(LNP-IIE); Rê o Doi o and AU NX 7 o Mer Me Mo (LNP-IIF)
[00356] [00356] In some of the above embodiments of Formula (LNP-III), the lipid has one of the following structures (LNP-IIIG), (LNP-IIIH), (LNP-II), or (LNP-IIIJ): Rà Rº Ds Rº O.N o. R o o (LNP-IIG); Rê Rô o A o son y z (LNP-IIIH); 'edition 870190141603, of 12/30/2019, page 22227/22358
[00357] [00357] In some of the above embodiments of Formula (LNP-III), n is an integer ranging from 2 to 12, for example from 2 to 8 or from 2 to 4. In some sports, n is 3, 4, 5 or 6. In some sports, n is 3. In some sports, n is 4. In some sports, n is 5. In some sports, n is 6. In some other of the above embodiments of Formula (LNP-III), y and z are each independently an integer ranging from 2 to 10. For example, in some embodiments, y and z are each independently an integer ranging from 4 to 9 or from 4 to 6. In some of the above embodiments of Formula (LNP-III), Rº is H. In other of the above embodiments, R6 is C1-C24 alkyl. In other embodiments, Rº is OH. In some embodiments of Formula (LNP-III), Gº is unsubstituted. In other modalities, G is replaced. In several different modalities, G is linear C1-C24 alkylene or linear C1-C24 alkenylene. In some other above embodiments of Formula (LNP-III), R or R', or both, is C6-C24 alkenyl. For example, in some modalities, R' and R , each independently, have the following structure: Ra H — + where: R”º and R7º are, in each occurrence, independently H 'edition 870190141603, of 12/30 /2019, pg. 22228/22358 or C1-C12 alkyl; and a is an integer from 2 to 12, wherein R' , RP and a are each selected such that R' and R' each independently comprise from 6 to 20 carbon atoms. For example, in some embodiments, a is an integer ranging from 5 to 9 or from 8 to 12. In some of the above embodiments of Formula (LNP-III), at least one occurrence of R'º is H. For example, in some embodiments, R”º is H on each occurrence. In embodiments other than the above, at least one occurrence of R'” is C1-Cs alkyl. For example, in some embodiments, C1 -C6 alkyl is methyl, ethyl, n-propyl, iso-propyl, n-butyl, iso-butyl, tert-butyl, n-hexyl or n-octyl.
[00358] [00358] “In different modalities of Formula (LNP-IlI), R' or R , or both, have one of the following structures: DUO, POCO, PUTO, do, RU, OT OO A AO, dO
[00359] [00359] In preferred embodiments, the LNP cationic lipid is a compound of formula (LNP-IIl), wherein: L' and L are each independently -O(C=O)- or (C=O)-O-; and R' º R , each independently, have one of the following structures: ROO RU TOO, ICSOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO CSONSOONOOO
[00360] [00360] In some of the above modalities of Formula (LNP-III), 'edition 870190141603, of 12/30/2019, p. 22229/22358
[00361] [00361] In preferred embodiments of the second aspect, the LNP cationic lipid is a compound of Formula (LNP-III), wherein R6 is OH.
[00362] [00362] In a particularly preferred embodiment, the artificial nucleic acid, preferably RNA of the first aspect is complexed with one or more lipids, thus forming lipid nanoparticles (LNP), in which the LNP is selected from structures (LNP-IIIl-1) to (LNP-111-36) (see Table 6). Table 6: Representative lipid compounds derived from Formula (LNP-III) NO structure == tee AT LNP-NI-1 º Ne o POVSCOTIO0O0U
[00363] [00363] In some embodiments, LNPs comprise a lipid of Formula (LNP-III), an artificial nucleic acid, preferably RNA of the first aspect, and one or more excipients selected from issue 870190141603, of 12/30/2019 , p. 22234/22358 Neutral Lipids, Steroids and PEGylated Lipids. In some modalities, the lipid of Formula (LNP-III) is compound (LNP-III-3). In some embodiments, the lipid of Formula (LNP-III) is compound (LNP-II1I-7).
[00364] [00364] In preferred embodiments, the LNP comprises a cationic lipid selected from: and CO THE
[00365] [00365] In a particularly preferred embodiment, the artificial nucleic acid, preferably RNA of the first aspect, is complexed with one or more lipids, thus forming lipid nanoparticles (LNP), wherein the LNP comprises the following cationic lipid (lipid according to Formula LNP-11I-3 of Table 6): 'edition 870190141603, of 12/30/2019, p. 22235/22358 te AUT o
[00366] [00366] In certain embodiments, the cationic lipid as defined herein, preferably as disclosed in Table 6, more preferably composed of the cationic lipid LNP-I1I-3, is present in the LNP in an amount from about 30 to about 95 percent in mol, in relation to the total lipid content of LNP. If more than one cationic lipid is incorporated into the LNP, these percentages apply to the combined cationic lipids.
[00367] [00367] In one embodiment, the cationic lipid is present in the LNP in an amount of about 30 to about 70 mole percent. In one embodiment, the cationic lipid is present in the LNP in an amount from about 40 to about 60 mole percent, such as about 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 , 50, 51, 52, 53, 54, 55, 56, 57, 58, 59 or 60 mol percent, respectively. In embodiments, the cationic lipid is present in the LNP in an amount of about 47 to about 48 mole percent, such as about
[00368] [00368] In some embodiments, the cationic lipid is present in a ratio of about 20 mol% to about 70 or 75 mol% or from about 45 to about 65 mol% or about 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, or about 70% in mol of the total lipid present in the LNP. In other embodiments, the LNPs comprise from about 25% to about 75% on a molar basis of cationic lipid, e.g. from about 20 to about 70%, from about 35 to about 870190141603, from 12/30/2019, page 22236/22358
[00369] [00369] In some embodiments of the invention, the LNP comprises a combination or mixture of any of the lipids described above.
[00370] [00370] Other adequate lipids are disclosed in WO2009 / 086558, -WO2009 / 127060, WOZ2010 / 048536, WOZ2010 / 054406, "WO2010 / 088537, WO2010 / 129709, WOZ2011 / 153493, US2011 / 0256175, US2012 / 0128760, US2012/0027803, US8158601, WOZ2016118724, WO2016118725, WO2017070613, WO2017070620, WO2017099823 and WO2017112865. In such a context, the descriptions of the WO2009 / 086558, -WO2009 / 127060, WOZ2010 / 048536, WOZ2010 / 054406, WO2010 / 088537, WO2010 / 129709, WO2011 / 153493, US2011 / 0256175, US2012 / 0128760, US2012 / 0027803, US8158601 WO2016 118724 , WO2016118725 , WO2017070613 , WO2017070620 , WO2017 099823 , and WO2017112865 specifically referring to (cationic) lipids suitable for LNPs are incorporated herein by reference.
[00371] [00371] In some embodiments, amino or cationic lipids, as defined herein, have at least one protonable or deprotonable group, such that the lipid is positively charged at a pH at or below physiological pH (e.g., pH 7 .4), and neutral at a second pH, preferably at or above physiological pH. It will of course be understood that the addition or removal of protons as a function of pH is an equilibrium process, and that reference to a neutral or charged lipid refers to the nature of the predominant species and does not require that all lipids be present. in 'edition 870190141603, of 12/30/2019, p. 22237/22358 charged or neutral form. Lipids having more than one protonable or deprotonable group, or which are zwitterionic, are not excluded and may likewise be suitable in the context of the present invention.
[00372] [00372] In some embodiments, the protonable lipids have a pKa of the protonable group in the range of about 4 to about 11, for example, a pKa of about 5 to about 7.
[00373] [00373] LNPs may comprise two or more (different) |cationic lipids. Cationic lipids can be selected to provide different advantageous properties. For example, cationic lipids that differ in properties, such as amine pKa, chemical stability, half-life in circulation, half-life in tissue, net tissue accumulation or toxicity, can be used in LNP. In particular, cationic lipids can be chosen so that the properties of the mixed LNP are more desirable than the properties of a single LNP of individual lipids.
[00374] [00374] The amount of the permanently cationic lipid or lipid can be selected taking into account the amount of nucleic acid charge. In one embodiment, these amounts are selected so that they result in an N/P ratio of the nanoparticles or composition in the range of about 0.1 to about 20. In this context, the N/P ratio is defined as the molar ratio of the nitrogen ("N") atoms of the nitrogen-containing basic groups of the lipid or lipids to the phosphate ("P") groups of the RNA that is used as a charge. The N/P ratio can be calculated on the basis that, for example, 1ug of RNA typically contains about 3nmol of phosphate residues, provided the RNA has a statistical distribution of bases. The "N" value of the lipid or lipid can be calculated based on its molecular weight and the relative content of permanently cationic groups and - if present - cationizable groups. 'edition 870190141603, of 12/30/2019, page 22238/22358
[00375] [00375] The characteristics and behavior of LNP in vivo can be modified by adding a hydrophilic polymer coating, eg polyethylene glycol (PEG), to the surface of LNP to provide steric stabilization. In addition, LNPs can be used for specific targeting by attaching ligands (eg, antibodies, peptides, and carbohydrates) to their surface or to the terminal end of attached PEG chains (eg, via PEGylated lipids).
[00376] [00376] In some embodiments, the LNPs comprise a polymer-conjugated lipid. The term "polymer-conjugated lipid" refers to a molecule comprising both a lipid moiety and a polymeric moiety. An example of a polymer-conjugated lipid is a PEGylated lipid. The term "PEGylated lipid" refers to a molecule comprising both a lipid moiety and a polyethylene glycol moiety. PEGylated lipids are known in the art and include 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoyl-glycerol (PEG-s-DMG) and the like.
[00377] [00377] Other suitable aminolipids include those that have alternative fatty acid groups and other dialkylamino groups, including those in which the alkyl substituents are different (e.g., N-ethyl-N-methylamino- and N-propyl- N-ethylamino-). In general, aminolipids that have less saturated acyl chains are more easily sized, especially when the complexes must be sized below about 0.3 micron for filter sterilization purposes. Aminolipids containing unsaturated fatty acids with carbon chain lengths in the range of Ci to Co can be used. Other scaffolds can also be used to separate the amino group and the fatty acid or fatty alkyl portion of the aminolipid.
[00378] [00378] —Aminolipids or cationic lipids may have at least 'edition 870190141603, 12/30/2019, p. 22239/22358 a protonable or deprotonable group such that the lipid is positively charged at one pH at or below physiological pH (e.g. pH 7.4), and neutral at a second pH, preferably at or above pH physiological. It will of course be understood that the addition or removal of protons as a function of pH is an equilibrium process, and that reference to a neutral or charged lipid refers to the nature of the predominant species and does not require that all the lipid be present. - be present in charged or neutral form. Lipids that have more than one protonable or deprotonable group, or that are zwitterionic, are not excluded from use in the invention.
[00379] [00379] Protonable lipids can have a pKa of the protonable group in the range of about 4 to about 11, for example a pKa of about 5 to about 7.
[00380] [00380] LNPs can include two or more cationic lipids. Cationic lipids can be selected to provide different advantageous properties. For example, cationic lipids that differ in properties, such as amine pKa, chemical stability, circulating half-life, tissue half-life, tissue net accumulation, or toxicity can be used in LNP. In particular, cationic lipids can be chosen so that the properties of the mixed LNP are more desirable than the properties of a single LNP of individual lipids.
[00381] [00381] The cationic lipid may be present in a ratio of about 20 mol% to about 70 or 75 mol% or from about 45 to about 65 mol% or about 20, 25, 30, 35 , 40, 45, 50, 55, 60, 65, or about 70% by mol of the total lipid present in the LNP. LNPs can comprise from about 25% to about 75% on a molar basis of cationic lipid, e.g. from about 20 to about 70%, from about 35 to about 65%, from about 45 to about 65% about 65%, about 60%, about 50%, or about 40% on a molar basis 22240/22358
[00382] [00382] The non-cationic lipid can be a neutral lipid, an anionic lipid, or an amphipathic lipid. Neutral lipids, when present, can be selected from any of several lipid species that exist in an uncharged or neutral zwitterionic form at physiological pH. Such lipids include, for example, diacylphosphatidylcholine, diacylphosphatidylethanolamine, ceramide, sphingomyelin, dihydrosphingomyelin, cephalin and cerebrosides. The selection of neutral lipids for use in the particles described in this document is generally guided by consideration of, for example, LNP size and stability of the LNP in the bloodstream. Preferably, the neutral lipid is a lipid with two acyl groups (eg, diacylphosphatidylcholine and diacylphosphatidylethanolamine).
[00383] [00383] Neutral lipids may contain saturated fatty acids with carbon chain lengths in the range of Cio to Cao. In other embodiments, neutral lipids with mono- or di-unsaturated fatty acids with carbon chain lengths in the range of Cio to C20o are used. Additionally or alternatively, neutral lipids with mixtures of saturated and unsaturated fatty acid chains can be used.
[00384] [00384] Suitable neutral lipids include, but are not limited to, 'issue 870190141603, 12/30/2019, pg. 22241/22358 distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethane POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoyl phosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), dimyristoylphosphatidylcholine (DMPC), distearoylphosphatidylethanolamine (DSPE), SM, 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), cholesterol, or a mixture thereof. Anionic lipids suitable for use in LNP's include, but are not limited to, phosphatidyl glycerol, cardiolipin, diacyl phosphatidylserine, diacylphosphatidic acid, N-dodecanoyl phosphatidylethanolamine, N-succinyl phosphatidylethanolamine, N-glutaryl phosphatidylethanolamine, lysylphosphatidylglycerol, and other modifying groups. anionic acid bound to neutral lipids.
[00385] [00385] Amphipathic lipids refer to any material used, wherein the hydrophobic portion of the lipid material orients towards a hydrophobic phase, while the hydrophilic portion orients towards the aqueous phase. Such compounds include, but are not limited to, phospholipids, aminolipids and sphingolipids. Representative phospholipids include sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyloleoyl phosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolidoline, dipalmitoylphosphatidylcholine, dioleoylphosphatidylcholine, distearoylphosphatidylcholine or dilinoleoylphosphatidylcholine. Other non-phosphorus compounds, such as sphingolipids, glycosphingolipid families, diacylglycerols and beta-acyloxyacids, can also be used.
[00386] [00386] In some embodiments, the LNPs comprise a neutral lipid selected from DSPC, DPPC, DMPC, DOPC, POPC, DOPE and SM. In various embodiments, the molar ratio of the cationic lipid to the 'edition 870190141603, of 12/30/2019, p. The neutral lipid ranges from about 2:1 to about 8:1.
[00387] [00387] In preferred embodiments, the neutral lipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC). The molar ratio of cationic lipid to DSPC can be in the range of about 2:1 to 8:1.
[00388] [00388] Non-cationic lipid may be present in a ratio of about 5 mol% to about 90 mol%, about 5 mol% to about 10 mol%, about 5, 10, 15, 20 , 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, or about 90% by mol of the total lipid present in the LNP.
[00389] [00389] LNPs can comprise from about 0% to about or 45% on a molar basis of neutral lipid, e.g. from about 3 to about 12% or from about 5 to about 10% . For example, LNPs can include about 15%, about 10%, about 7.5%, or about 7.1% neutral lipid on a molar basis (based on 100% total moles of lipid at LNP). (iii) Sterols
[00390] [00390] The sterol may preferably be cholesterol.
[00391] [00391] The sterol can be present in a ratio of about 10 mol% to about 60 mol% or about 25 mol% to about 40 mol% of the LNP. Sterol may be present in a ratio of about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or about 60% by mole of the total lipid present in the LNP. LNPs can comprise from about 5% to about 50% on a molar basis of the sterol, e.g. about 15% to about 45%, about 20% to about 40%, about 48%, about 40%, about 38.5%, about 35%, about 34.4%, about 31.5%, or about 31% on a molar basis (based on 100% total moles of lipid at LNP). (iv) Aggregation Reduction Agents
[00392] [00392] The aggregation reducing agent may be a lipid capable of reducing aggregation.
[00393] [00393] “Examples of such lipids include, but are not limited to, lipids modified by polyethylene glycol (PEG), monosialoganglioside Gml, and polyamide oligomers (PAO), such as those described in US Patent No. 6,320,017, which is incorporated by reference in its entirety. Other compounds with uncharged, hydrophilic, steric barrier moieties that prevent aggregation during formulation, such as PEG, Gml or ATTA, can also be coupled to lipids. ATTA lipids are described, for example, in US Patent No. 6,320,017, and PEG-lipid conjugates are described, for example, in US Patent Nos. 5,820,873, 5,534,499 and 5,885,613, each of which is incorporated by reference in its entirety.
[00394] [00394] The aggregation reducing agent may be, for example, selected from a polyethylene glycol (PEG)-lipid including, without limitation, a PEG-diacylglycerol (DAG), a PEG-dialkylglycerol, a PEG-dialkyloxypropyl (DAA). ), a PEG-phospholipid, a PEG-ceramide (Cer), or a mixture thereof (such as PEG-Ceri or PEG-Cer2o). The PEG-DAA conjugate can be, for example, a PEG-dilauryloxypropyl (C12), a PEG-dimyristyloxypropyl (C14), a PEG-dipalmytyloxypropyl (C16), or a PEG-distearyloxypropyl (C18). Other pegylated lipids include, but are not limited to, polyethylene glycol-didymyristoyl glycerol (C14-PEG or PEG-C14, where PEG has an average molecular weight of 2000 Da) (PEG-DMG); (R)-2,3-bis(octadecyloxy)propyl-1-(methoxypoly(ethylene glycol) 2000)propylcarbamate) (PEG-DSG); PEG-carbamoyl-1,2-dimyristyloxy-propylamine, wherein PEG has an average molecular weight of 2000 Da (PEG-CDMA); N-Acetylgalactosamine-((R)-2,3-bis(octadecylooxy)propyl-1-(methoxypoly(ethylene — glycol)2000)propylcarbamate)) — (GalNAc-PEG-DSG); mPEG (mw2000)-diastearoylphosphatidyl-ethanolamine (PEG-DSPE); and polyethylene glycol-dipalmitoylglycerol (PEG-DPG).
[00395] [00395] — Preferably, the aggregation reducing agent may be selected from PEG-DMG or PEG-c-DMA.
[00396] [00396] In preferred embodiments, the artificial nucleic acid, preferably RNA of the first aspect is complexed with one or more lipids, thus forming lipid nanoparticles (LNP), wherein the LNP additionally comprises a PEGylated lipid having the Formula (LNP-IV): the “. PALA RO LNPV) or a pharmaceutically acceptable salt, tautomer or stereoisomer thereof, wherein R$ and Rº are each independently a saturated or unsaturated, straight or branched alkyl chain containing from to 30 carbon atoms, wherein the chain alkyl is optionally interrupted by one or more ester bonds; and w has an average value ranging from 30 to 60.
[00397] [00397] In some of the above embodiments of PEGylated lipid according to formula (LNP-IV), Rê and Rº are not both n-octadecyl when w is 42. In some other embodiments, Rº and Rº are each independently a saturated or unsaturated, straight or branched alkyl chain containing from 10 to 18 carbon atoms. In some embodiments, R6 and R6 are each independently a saturated or unsaturated, straight or branched alkyl chain containing from 12 to 16 carbon atoms. In some embodiments, R6 and R6 are each independently a saturated or unsaturated, straight or branched alkyl chain containing 12 carbon atoms. In some embodiments, R° and R° are each independently a saturated or unsaturated, straight or branched alkyl chain containing 14 carbon atoms. In other embodiments, R6 and R6 are each independently a saturated or unsaturated, straight or branched alkyl chain containing 16 carbon atoms. In still other embodiments, R6 and R6 are each independently a saturated or unsaturated alkyl chain, reprint 870190141603, 12/30/2019, p. 22245/22358 ta or branched containing 18 carbon atoms. In still other embodiments, R6 is a saturated or unsaturated, straight or branched alkyl chain containing 12 carbon atoms and R6 is a saturated or unsaturated, straight or branched alkyl chain containing 14 carbon atoms.
[00398] [00398] In various embodiments, w encompasses a range that is selected such that the PEG portion of the PEGylated lipid according to formula (LNP-IV) has an average molecular weight of about 400 to about 6000 g/mol . In some embodiments, the average w is about
[00399] [00399] In preferred embodiments of the second aspect, R6 and R6 of the PEGylated lipid according to formula (LNP-IV) are saturated alkyl chains.
[00400] [00400] In a particularly preferred embodiment of the second aspect, the artificial RNA of the first aspect is complexed with one or more lipids, thus forming lipid nanoparticles (LNP), wherein the LNP additionally comprises a PEGylated lipid, wherein the PEG lipid is of Formula (LNP-IVa) the
[00401] [00401] In other embodiments, the PEGylated lipid has one of the following structures: AAA AAA
[00402] [00402] Other examples of PEG-lipids suitable in such a context are provided in US20150376115A1 and WO2015199952, each of which is incorporated by reference in its entirety.
[00403] [00403] In some embodiments, the LNPs include less than about 3, 2, or 1 mole percent of PEG or PEG-modified lipid, based on the total moles of lipid in the LNP. In other embodiments, LNPs comprise from about 0.1% to about 20% of the PEG-modified lipid on a molar basis, for example, about 0.5 to about 10%, about 0.5 about 5%, about 10%, about 5%, about 3.5%, about 3%, about 2.5%, about 2%, about 1.5%, about of 1%, about 0.5%, or about 0.3% on a molar basis (based on 100% of total moles of lipids in the LNP). In preferred embodiments, the LNPs comprise from about 1.0% to about 2.0% of the PEG-modified lipid on a molar basis, for example, about 1.2 to about 1.9%, about 1 .2 to about 1.8%, about 1.3 to about 1.8%, about 1.4 to about 1.8%, about 1.5 to about 1.8%, about from 1.6 to about 1.8%, in partition 870190141603, of 12/30/2019, p. 22247/22358 cular, about 1.4%, about 1.5%, about 1.6%, about 1.7%, about 1.8%, about 1.9%, most preferably 1 .7% (based on 100% total moles of lipid in the LNP).
[00404] [00404] In various embodiments, the molar ratio of cationic lipid to PEGylated lipid ranges from about 100:1 to about 25:1. Composition of the LNP
[00405] [00405] The composition of LNPs can be influenced, inter alia, by the selection of the cationic lipid component, the degree of daturation of the cationic lipid, the nature of PEGylation, the ratio of all components and biophysical parameters such as like your size. In an example by Semple et al. (Semple et al. Nature Biotech. 2010 28: 172-176; incorporated herein by reference in its entirety), the composition of LNP was composed of 57.1% cationic lipid, 7.1% dipalmitoylphosphatidylcholine, 34 .3% cholesterol, and 1.4% PEG-c-DMA (Basha et al. Mol Ther. 2011 19:2186-2200; incorporated herein by reference in its entirety).
[00406] [00406] LNPs can comprise from about 35 to about 45% cationic lipid, from about 40% to about 50% cationic lipid, from about 50% to about 60% cationic lipid and/or from about 55% to about 65% cationic lipid. The lipid to nucleic acid ratio can range from about 5:1 to about 20:1, from about 10:1 to about 25:1, from about 15:1 to about 30:1, and/or at least 30:1.
[00407] [00407] The average molecular weight of the PEG moiety in the PEG-modified lipid can range from about 500 to about 8000 Daltons (eg from about 1000 to about 4000 Daltons). In a preferred embodiment, the average molecular weight of the PEG moiety is about 2000 Daltons.
[00408] [00408] The concentration of the aggregation reducing agent can vary from about 0.1 to about 15% by mol, per 100% of moles to-'ethition 870190141603, of 12/30/2019, p. 22248/22358 such lipid in the LNP. In some embodiments, the LNPs include less than about 3, 2, or 1 mole percent of PEG or PEG-modified lipid, based on the total moles of lipid in the LNP. In other embodiments, the LNPs comprise from about 0.1% to about 20% of the PEG-modified lipid on a molar basis, for example, about 0.5 to about 10%, about 0.5 about 5%, about 10%, about 5%, about 3.5%, about 1.5%, about 0.5%, or about 0.3% on a molar basis (with based on 100% total moles of lipids in the LNP).
[00409] [00409] Different LNPs having various molar ratios of cationic lipid, non-cationic (or neutral) lipid, sterol (eg, cholesterol), and aggregation-reducing agent (such as a PEG-modified lipid) on a molar basis (based on the total moles of lipid in the lipid nanoparticles), as shown in Table 7 below. In preferred embodiments, the lipid nanoparticle formulation of the invention essentially consists of a mixture of lipid in molar ratios of about 20-70% cationic lipid: 5-45% neutral lipid: 20-55% cholesterol, 0.5 -15% PEG-modified lipid, more preferably in molar ratios of about 20-60% cationic lipid: 5-25% neutral lipid: 25-55% cholesterol: 0.5-15% modified lipid by PEG.
[00410] [00410] LNPs can occur as liposomes or lipoplexes as described in more detail below.
[00411] [00411] — Preferably, lipid nanoparticles (LNPs) comprise: (a) at least one artificial nucleic acid, preferably RNA, (b) a cationic lipid, (c) an aggregation reducing agent (such as polyethylene glycol (PEG) lipid or PEG-modified lipid), (d) optionally a non-cationic lipid (such as a neutral lipid), and (e) optionally, a sterol.
[00412] [00412] In some embodiments, the LNPs comprise a lipid of Formula (LNP-III), an artificial nucleic acid, preferably RNA as defined above, a neutral lipid, a steroid and a PEGylated lipid. In preferred embodiments, the lipid of Formula (LNP-III) is composed of lipid (LNP-11I-3), the neutral lipid is DSPC, the steroid is cholesterol, and the PEGylated lipid is the compound of Formula (LNP-IVa) .
[00413] [00413] In a preferred embodiment, the LNP essentially consists of (i) at least one cationic lipid; (ii) a neutral lipid; (iii) a sterol, for example cholesterol; and (iv) a PEG-lipid, eg PEG-DMG or PEG-cDMA, in a molar ratio of about 20-60% cationic lipid: 5-25% neutral lipid: 25-55% sterol; 0.5-15% PEG-lipid.
[00414] [00414] In particularly preferred embodiments of the second aspect, the artificial nucleic acid, preferably RNA, of the first aspect is complexed with one or more lipids, thereby forming lipid nanoparticles (LNPs), wherein the LNP essentially consists of (i.e. ) at least one cationic lipid as defined herein, preferably a lipid of Formula (LNP-III), more preferably lipid (LNP-111-3); (ii) a neutral lipid as defined herein, preference 870190141603, dated 12/30/2019, pg. 22251/22358 essentially 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC); (iii) a steroid or steroid analogue as defined herein, preferably cholesterol; and (iv) a PEG-lipid as defined herein, for example PEG-DMG or PEG-cDMA, preferably a PE-Gylated lipid of Formula (LNP-IVa), wherein (i) to (iv) are in a molar ratio of about 20-60% cationic lipid: 5-25% neutral lipid: 25-55% sterol; 0.5-15% PEG-lipid.
[00415] [00415] In a preferred embodiment, the lipid nanoparticle comprises: a cationic lipid with Formula (LNP-IlI) and/or PEG lipid with Formula (LNP-IV), optionally a neutral lipid, preferably 1,2 -distearoyl-sn-glycero-3-phosphocholine (DSPC) and optionally a steroid, preferably cholesterol, wherein the molar ratio of cationic lipid to DSPC is optionally in the range of about 2:1 to 8:1, wherein the molar ratio of cationic lipid to cholesterol is optionally in the range of about 2:1 to 1:1.
[00416] [00416] In a particular preferred embodiment, the lipid nanoparticles (LNPs) have a molar ratio of approximately 50:10: 38.5:1.5, preferably 47.5:10:40.8:1.7 or more preferably 47.4:10:40.9:1.7 (i.e. proportion (% in mol) of cationic lipid (preferably LNP-III-3 lipid), DSPC, cholesterol and PEG-lipid ((preferably PEG -lipid of Formula (LNP-IVa) with n = 49); solubilized in ethanol).
[00417] [00417] The total amount of nucleic acid, preferably RNA, in the lipid nanoparticles can vary and is defined depending, for example, on the ratio p/p RNA to total lipid. In one embodiment of the invention, the artificial nucleic acid, preferably the RNA to total lipid ratio is less than 0.06 w/w, preferably between 0.03 w/w and 0.04 w/w.
[00418] [00418] “According to some embodiments, LNPs have an average diameter size of about 50 nm to about 300 nm, such as from about 50 nm to about 250 nm, for example from about 50 nm to about 250 nm. 50 nm to about 200 nm.
[00419] [00419] Under some embodiments, smaller LNPs may be used. Such particles may comprise a diameter of less than 0.1 µm to 100 nm, such as, but not limited to, less than 0.1 µm, less than 1.0 µm, less than 5 µm, less than 10 µm. one, less than 15 um, less than 20 um, less than 25 um, less than 30 um, less than 35 um, less than 40 um, less than 50 um, less than 55 um, less than 60 um, less than 65 um, less than 70 um, less than 75 um, less than 80 um, less than 85 um, less than 90 um, less than 95 um, less than 100 um, less than 125 um, less than 150 um, less than 175 um, less than 200 um, less than 225 um, less than 250 um, less than 275 um, less than than 300 um, less than 325 um, less than 350 um, less than 375 um, less than 400 um, less than 425 um, less than 450 um, less than 475 um, less than 500 um one, less than 525 um, less than 550 um, less than 575 um, less than 600 um, less than 625 um, less than 650 um, less than d what 675 um, less than 700 um, less than 725 um, less than 750 um, less than 775 um, less than 800 um, less than 825 um, less than 850 um, less than 875 µm, less than 900 µm, less than 925 µm, less than 950 µm, less than 975 µm, In other embodiments, nucleic acids can be delivered using smaller LNPs that can comprise a diameter of about 1 nm to about 100 nm, from about 1 nm to about nm, about 1 nm to about 20 nm, from about 1 nm to about 'edition 870190141603, 12/30/2019, pg. 22253/22358
[00420] [00420] “According to some embodiments, the LNP may have a diameter greater than 100 nm, greater than 150 nm, greater than 200 nm, greater than 250 nm, greater than 300 nm, greater than 350 nm, greater than 400 nm, greater than 450 nm, greater than 500 nm, greater than 550 nm, greater than 600 nm, greater than 650 nm, greater than 700 nm, greater than 750 nm, greater than 800 nm, greater than 850 nm, greater than 900 nm, greater than 950 nm or greater than 1000 nm.
[00421] [00421] According to other embodiments, LNPs have a single-mode particle size distribution (i.e. they are not bi- or polymodal). ). Other Components
[00422] [00422] LNPs may further comprise one or more lipids and/or other components in addition to those mentioned above.
[00423] [00423] Other lipids can be included in liposome compositions for a variety of purposes, such as to prevent lipid oxidation or to attach ligands to the surface of the liposome. Any number of lipids can be present in LNP's, including amphipathic, neutral, cationic and anionic lipids. These lipids can be used alone or in combination.
[00424] [00424] “Additional components that may be present in an LNP include bilayer stabilizing components such as polyamide oligomers (see, for example, US Patent No.
[00425] [00425] In some embodiments, artificial nucleic acid molecules, preferably RNAs, or any other nucleic acid disclosed herein, are formulated/provided as liposomes.
[00426] [00426] Cationic lipid-based liposomes are capable of forming complexes with negatively charged nucleic acids (e.g., RNAs) through electrostatic interactions, resulting in complexes that offer biocompatibility, low toxicity, and the possibility of the large-scale production required for in vivo clinical applications. Liposomes can fuse with the plasma membrane for absorption; once inside the cell, the liposomes are processed via the endocytic pathway and the nucleic acid is then released from the endosome/vehicle into the cytoplasm. Liposomes have long been viewed as drug delivery vehicles due to their superior biocompatibility, given that liposomes are basically ana- 22255/22358 biological membranes and can be prepared from natural or synthetic phospholipids (Int J] Nanomedicine. 2014; 9: 1833-1843 ).
[00427] [00427] Liposomes typically consist of a lipid bilayer that may be composed of cationic, anionic or neutral (phospho)lipids and cholesterol, which contains an aqueous core. Both the lipid bilayer and the aqueous space can incorporate hydrophobic or hydrophilic compounds, respectively. Liposomes may have one or more lipid membranes. Liposomes can be single layered, referred to as unilamellar, or multilayered, referred to as multilamellar.
[00428] [00428] The characteristics and behavior of liposomes in vivo can be modified by adding a hydrophilic polymer coating, eg polyethylene glycol (PEG), to the liposomal surface to impart steric stabilization. In addition, liposomes can be used for specific targeting by binding ligands (eg, antibodies, peptides, and carbohydrates) on their surface or at the terminal end of coupled PEG chains (Front Pharmacol. 2015 Dec 1; 6:286). ).
[00429] [00429] Liposomes are typically present as spherical vesicles and can vary in size from 20 nm to a few microns.
[00430] [00430] Liposomes can be of different sizes, such as, but not limited to, a multilamellar vesicle (MLV) that can be hundreds of nanometers in diameter and can use a series of concentric bilayers separated by narrow aqueous compartments, a small unicellular vesicle (SUV) that can be smaller than 50 nm in diameter, and a large unilamellar vesicle (LUV) that can be between 50 and 500 nm in diameter. Liposome design may include, but are not limited to, opsonins or ligands, to enhance binding of liposomes to unhealthy tissues or to trigger events, such as, 'Edition 870190141603, 12/30/2019, pg. 22256/22358 but not limited to, endocytosis. Liposomes can contain a low or high pH and improve delivery of pharmaceutical formulations.
[00431] [00431] As a non-limiting example, liposomes such as synthetic membrane vesicles can be prepared by the methods, apparatus and devices described in US Patent Publication US20130177638, US20130177637, US20130177636, US2013 0177635, —US2013017634, US203301776 , US20130183375, US20130183373 and US20130183372, the contents of each of which are incorporated herein by reference in their entirety. The artificial nucleic acid molecule, preferably RNA, of the invention, and/or any other nucleic acid disclosed herein, may be encapsulated by the liposome and/or may be contained in an aqueous core which can then be encapsulated by the liposome (see International Pub Nos. WO2012031046, WO2012 031043, WO2012030901 and WO2012006378 and US Patent Publication Nos. US20130189351, US20130195969 and US20130202684; the contents of each of which are incorporated herein by reference in their entirety).
[00432] [00432] In some embodiments, the artificial nucleic acid molecule, preferably RNA, of the invention or any other nucleic acid disclosed herein may be formulated in liposomes, such as, but not limited to, DiLa2 liposomes (Marina Biotech, Bothell , WA), SMARTICLESO (Marina Biotech, Bothell, WA), neutral DOPC-based liposomes (1,2-dioleoyl-sn-glycero-3-phosphocholine) (e.g., siRNA delivery for ovarian cancer (Landen et al., Cancer Biology & Terapy 2006 5(12)1708-1713; incorporated herein by reference in its entirety) and hyaluronan-coated liposomes (Quiet Therapeutics, Israel). lipoplexes
[00433] [00433] “According to some embodiments, the acid molecule 'ethition 870190141603, of 12/30/2019, p. 22257/22358 artificial nucleic acids, preferably RNAs, and/or any other nucleic acid disclosed herein, are provided/formulated as lipoplexes, i.e., cationic lipid bilayers sandwiched between nucleic acid layers.
[00434] [00434] Cationic lipids such as DOTAP, (1,2-dioleoyl-3-trimethylammonium-propane) and DOTMA (N-[1-(2,3-dioleoyloxy)propyl]-N,N N-trime- thi-ammonium methyl sulfate) can form complexes or lipoplexes with negatively charged nucleic acids to form nanoparticles by electrostatic interaction, providing high transfection efficiency in vitro. Nanoliposomes
[00435] [00435] "According to some embodiments, the artificial nucleic acid molecule, preferably RNAs, or any other nucleic acid disclosed herein, are provided/formulated as neutral lipid-based nanoliposomes, such as 1,2 -dioleoyl-sn-glycero-3-phosphatidylcholine (DOPC) ( Adv Drug Deliv Rev. 2014 Feb; 66: 110-116 ). emulsions
[00436] [00436] In some embodiments, the artificial nucleic acid molecule, preferably RNAs, and/or any other nucleic acid disclosed herein, are provided/formulated as emulsions. In another embodiment, said artificial nucleic acid molecule, preferably RNAs, or any other nucleic acid disclosed herein, is formulated in a cationic oil-in-water emulsion, wherein the emulsion particle comprises an oil core and a cationic lipid that can interact with the nucleic acid(s) that anchor the molecule in the emulsion particle (see International Pub. No. WO2012006380; incorporated herein by reference in its entirety ). In some embodiments, said artificial nucleic acid molecule, preferably RNA, 'edition 870190141603, 12/30/2019, pg. 22258/22358 or any other nucleic acid disclosed herein, is formulated in a water-in-oil emulsion, comprising a continuous hydrophobic phase, wherein the hydrophilic phase is dispersed. As a non-limiting example, the emulsion can be produced by the methods described in International Publication No. WO201087791, the contents of which are incorporated herein by reference in their entirety. (Poly-)cationic Compounds and Polymeric Vehicles
[00437] [00437] According to preferred embodiments, the artificial nucleic acid molecule, preferably RNA, of the invention, and/or any other nucleic acid disclosed herein, is complexed or associated with a cationic or polycationic compound ("compound (poly-)cationic") and/or a polymeric carrier.
[00438] [00438] The term "(poly-)cationic compound" typically refers to a charged molecule, which is positively charged (cation) at a pH value typically from 1 to 9, preferably at a pH value of or below 9 (e.g. 5 to 9), at or below 8 (e.g. 5 to 8), at or below 7 (e.g. 5 to 7), more preferably at a physiological pH, e.g. from 7.3 to RT.
[00439] [00439] Accordingly, a "(poly-)cationic compound" can be any positively charged compound or polymer, preferably a cationic peptide or protein, that is positively charged under physiological conditions, particularly under physiological conditions. in vivo. A "(poly-)cationic peptide or protein" may contain at least one positively charged amino acid, or more than one positively charged amino acid, for example selected from Arg, His, Lys or Orn as described below. (Poly-)cationic Amino Acids, Peptides and Proteins
[00440] [00440] “(poly-)cationic compounds that are agents particularly 'ethition 870190141603, of 12/30/2019, p. 22259/22358 for complexing or associating the artificial nucleic acid molecule, preferably RNA, of the invention, or any other nucleic acid disclosed herein, include protamine, nucleolin, spermine or spermidine, or other peptides or proteins thionic compounds such as poly-L-lysine (PLL), polyarginine, basic polypeptides, cell-penetrating peptides (CPPs), including HIV binding peptides, HIV-1 Tat (HIV), Tat-derived peptides, Penetrati- na, peptides analogous or derivatives of VP22, HSV VP22 (Herpes simplex), MAP, KALA or protein transduction domains (PTDs), PpT620, proline-rich peptides, arginine-rich peptides, lysine-rich peptides, peptide( s) MPG, Pep-1, L-oligomers, calcitonin peptide(s), peptides derived from antennapedia (particularly Drosophila Antennapedia), pAntp, plsl, FGF, Lactoferrin, Transportan, Buforin-2, Bac715-24 , SynB, SynB (1), pVEC, peptides derived from hCT, SAP, or histones. More preferably, the artificial nucleic acid molecule, preferably RNA, of the invention, or any other nucleic acid disclosed herein, is complexed with protamine or oligofectamine, more preferably with protamine.
[00441] [00441] — Alternatively or additionally, such cationic or polycationic peptides or proteins may be selected from proteins or peptides of the following general formula (CAT-I): t(Arg);(Lys)m;(His) n;(Orn)6;(Xaa).); (CAT-I) where | +m + n+o+x=8-15,el,m,n or o independently of each other can be any number selected from 0, 1, 2,3,4,5,6,7, 8, 9, 10, 11, 12, 13, 14 or 15, provided that the general content of Arg, Lys, His and Orn represents at least 50% of all amino acids in the oligopeptide; and Xaa can be any amino acid selected from native (= naturally occurring) or non-native amino acids, except from Arg, Lys, His or Orn; and x can be any number selected from 0, 1, 2, 'edition 870190141603, 12/30/2019, pg. 22260/22358
[00442] [00442] In this context, the disclosure of WO 2009/030481 is incorporated herein by reference. (Poly-)cationic Polysaccharides
[00443] [00443] "Other (poly-)cationic compounds preferred for complexing or association with the artificial nucleic acid molecule, preferably RNA, of the invention or any other nucleic acid disclosed herein include (poly-)cationic polysaccharides, for example , chitosan, polybrene, cationic polymers, eg polyethyleneimine (PEI). (Poly-)Cationic Lipids
[00444] [00444] - Other preferred (poly-)cationic compounds for complexing or associating with the artificial nucleic acid molecule, preferably RNA, of the invention or any other nucleic acid disclosed herein include (poly-)cationic lipids, for example , DOTMA: [1-(2,3-sioleyloxy)propyl)]-N,N, N-trimethylammonium chloride, DMRIE, di-Ci4-amidine, DOTIM, SAINT, DC-Chol, BGTC, CTAP, DOPC , DODAP, DOPE: Dioleyl phosphatidylethanol-amine, DOSPA, DODAB, DOIC, DMEPC, DOGS: Dioctadecylamidoglycylspermine, DIMRI: Dimyristo-oxypropyl dimethyl hydroxyethyl ammonium bromide, DOTAP: dioleoyloxy-3-(trimethylammonium)propane, DC-6-14: O,O-ditetradecanoyl-N-(alpha-trimethylammonium-acetyl)-diethanolamine chloride, CLIP1: rac-[(2,3-dioctadecyloxypropyl)(2-hydroxyethyl)])-dimethylammonium chloride, CLIP6: rac- [2(2,3-dihexadecyloxypropyl-oxymethyloxy)ethyl]trimethylammonium, CLIP9: rac-[2(2,3-dihexadecyl-oxypropyl-oxysuccinyloxy)ethyl]-trimethylammonium, or oligofectamine.
[00445] [00445] - Other preferred (poly-)cationic compounds for complexing or associating with the artificial nucleic acid molecule, preferably RNA, of the invention or any other nucleic acid disclosed herein, include (poly-)cationic polymers, for example for example, modified polyamino acids such as beta-amino acid polymers or reverse polyamides etc., modified polyethylenes such as PVP (poly(N-ethyl-4-vinylpyridinium bromide)) etc., modified acrylates such as pDMAEMA (poly( dimethylaminoethyl methylacrylate)) etc., modified amidoamines such as pAMAM (poly(amidoamine)) etc., modified polybetaaminoester (PBAE) such as 1,4-butanediol diacrylate-co-5-amino-1-pentanol polymers modified by diamine end etc., dendrimers such as polypropylamine dendrimers or dendrimers based on pAMAM etc., polyimine(s) such as PEI: poly(ethyleneimine), poly(propyleneimine) etc., polyallylamine, backbone based polymers sugar, such as cyclodextrin based polymers, dextran based polymers, chitosan etc., silane backbone based polymers such as PMOXA-PDMS copolymers etc., or block polymers consisting of a combination of one or more cationic blocks (eg selected from a cationic polymer as mentioned above) and from one or more hydrophilic or hydrophobic blocks (eg polyethylene glycol). Polymer Vehicles
[00446] [00446] "According to preferred embodiments, the artificial nucleic acid molecule, preferably RNA, of the invention or any other nucleic acid disclosed herein may be complexed or associated with a polymeric carrier.
[00447] [00447] A "polymeric carrier" used in accordance with the invention may be a polymeric carrier formed from disulfide crosslinked cationic components. The cationic components cross-linked by 'edition 870190141603, of 12/30/2019, p. 22262/22358 disulfide can be the same or different from each other. The polymeric carrier may also contain other components.
[00448] [00448] It is also particularly preferred that the polymeric carrier used in accordance with the present invention comprises mixtures of peptides, proteins or cationic polymers and, optionally, other components, as defined herein, which are cross-linked by disulfide bonds, as described in this document. In this context, the disclosure of WO 2012/013326 is incorporated herein by reference.
[00449] [00449] “In this context, the cationic components, which form the basis for the polymeric vehicle by disulfide crosslinking, are typically selected from any peptide, protein or (poly)cationic polymer suitable for this purpose, any peptide, protein or particular (poly-)cationic polymer capable of complexing, and thus preferably condensing, the artificial nucleic acid molecule, preferably RNA, of the invention, or any other nucleic acid, as disclosed herein. The (poly-)cationic peptide, protein or polymer is preferably a linear molecule, however, branched (poly-)cationic peptides, proteins or polymers may also be used.
[00450] [00450] Each protein, peptide or disulfide cross-linked (poly-)cationic polymer of the polymeric carrier, which can be used to complex the artificial nucleic acid molecule, preferably RNA, or any other nucleic acid disclosed herein, preferably contains at least one -SH moiety, more preferably at least one cysteine residue or any other chemical group exhibiting an -SH moiety, capable of forming a disulfide bond upon condensation with at least one protein, peptide or polymer (poly-) additional cationic component as a cationic component of the polymeric vehicle, as mentioned in this document. 'edition 870190141603, of 12/30/2019, page 22263/22358
[00451] [00451] According to a first alternative, at least one (poly-)cationic component of the polymeric carrier, which can be used to complex the artificial nucleic acid molecule, preferably RNA, or any other nucleic acid disclosed in this document. can be selected from (poly-)cationic peptides or proteins. Such (poly-)cationic peptides or proteins preferably exhibit a length of about 3 to 100 amino acids, preferably a length of about 3 to 50 amino acids, more preferably a length of about 3 to 25 amino acids, for example , a length of about 3 to 10, 5 to 15, 10 to 20 or 25 amino acids. Alternatively or additionally, such (poly-)cationic peptides or proteins may exhibit a molecular weight of from about 0.01 kDa to about 100 kDa, including a molecular weight of from about 0.5 kDa to about 100 kDa, preferably from about 10 kDa to about 50 kDa, even more preferably from about 10 kDa to about 30 kDa.
[00452] [00452] In the specific case that the cationic component of the polymeric vehicle comprises a (poly-)cationic peptide or protein, the cationic properties of the (poly-)cationic peptide or protein or of the entire polymeric vehicle, if the polymeric vehicle is entirely with - made up of (poly-)cationic peptides or proteins, they can be determined according to their cationic amino acid content. Preferably, the content of cationic amino acids in the peptide or protein (poly-ethion 870190141603, of 12/30/2019, page 22264/22358
[00453] [00453] According to a preferred embodiment, the (poly-)cationic peptide or protein of the polymeric carrier, when defined according to Formula ((Arg);(Lys)m;(His)n;(Orn)s; (Xaa).) (formula (CAT-I)), as shown above and which comprises or is further modified to comprise at least a —SH moiety, may be, without being restricted thereto, selected from the subformula (CAT- la): t(Arg);(Lys)m;(His)n;(Orn)o;(Xaa'). (Cys),) (CAT-la) wherein (Arg)s(Lys)m;(His)n;(Orn)o; ex are as defined in this document, Xaa' is any amino acid selected from native (= naturally occurring) or non-native amino acids other than Arg, Lys, His, Orn or Cys and y is any number selected from O, 1 , 2, 3, 4, 5, 6.7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21-30, 31-40, 41-50 , 51-60, 61-70, 71-80 and 81-90, provided that the general content of Arg (Arginine), Lys (Lysine), His (Histidine) and Orn (Ornithine) represents at least 10% of all oligopeptide amino acids.
[00454] [00454] This modality can apply to situations in which the peptide or (poly-)cationic protein of the polymeric vehicle, for example, when defined according to the empirical formula (Arg);;(Lys)m;(His )n;(Orn)o;(Xaa). (formula (CAT-I)) as shown above, comprises or has been modified by at least one cysteine as a —-SH moiety in the above meaning, such that the cationic or polycationic peptide as the cationic component carries at least one cysteine, which is capable of form a disulfide bond with other components of the polymeric carrier.
[00455] [00455] “Examples may comprise any of the following sequences: Cys(Arg;) (SEQ ID NO: 3048), Cys(Args) (SEQ ID NO: 3049), Cys(Args) (SEQ ID NO: 3050 ), Cys(Arg:o) (SEQ ID NO: 3051), Cys(Arg:1) (SEQ ID NO: 3052), Cys(Arg2) (SEQ ID NO: 3047), Cys(Arg:3) (SEQ ID NO: 3053), Cys(Argu) (SEQ ID NO: 3054), Cys(Arg:s) (SEQ ID NO: 3055), Cys(Arg:s) (SEQ ID NO: 3056), Cys(Arg: 7) (SEQ ID NO: 3057), Cys(Arg:s) (SEQ ID NO: 3058), Cys(Arg19) (SEQ ID NO: 3059), Cys(Arg2o) (SEQ ID NO: 3060).
[00456] [00456] According to another particularly preferred embodiment, the (poly-)cationic peptide or protein of the polymeric carrier, when defined according to the Formula ((Arg);(Lys)m;(His)n;(Orn)o ;(Xaa).) (formula (CAT-I)) as shown above can be, without being restricted thereto, selected from the subformula (CAT-Ib): Cys1 ((Arg);(Lys)m;(His) n;(Orn)o;(Xaa).) Cys2 — (CAT-Ib) where the empirical formula ((Arg):;(Lys)m;(His)n;(Orn)o;(Xaa.) (formula (CAT-I) is as defined herein and forms a core of an amino acid sequence according to the (semi-empirical) formula (CAT-II) and wherein Cys1 and Cys2 are cysteines proximal to or terminal to ( Arg);(Lys)m;(His)n;(Orn).;(Xaa).. Examples may comprise any of the above sequences flanked by two Cys 'edition 870190141603, of 12/30/2019, p. 22266/22358 and following sequences: Cys(Arg7z)Cys (SEQ ID NO: 3033), Cys(Args)Cys (SEQ ID NO: 3034), Cys(Args)Cys (SEQ ID NO: 3035), Cys(Arg1o )Cys (SEQ ID NO: 3036), Cys(Arg11)Cys ( SEQ ID NO: 3037), Cys(Arg12)Cys (SEQ ID NO: 3046), Cys(Arg1:3)Cys (SEQ ID NO: 3038), Cys(Arg1u)Cys (SEQ ID NO: 3039), Cys( Arg15s)Cys (SEQ ID NO: 3040), Cys(Arg1s)Cys (SEQ ID NO: 3041), Cys(Arg1:7)Cys (SEQ ID NO: 3042), Cys(Arg1:8)Cys (SEQ ID NO : 3043), Cys(Arg1s)Cys (SEQ ID NO: 3044), Cys(Arg20)Cys (SEQ ID NO: 3045).
[00457] [00457] This modality can apply to situations where the peptide or protein (poly-)cationic of the polymeric vehicle, for example, when defined according to the empirical formula (Arg);(Lys)m;(His)n ; (Orn)o;(Xaa). (CAT-I), as shown above, has been modified with at least two cysteines as -SH moieties in the above meaning, such that the cationic or polycationic peptide or polymeric carrier charge complex as a cationic component carries at least two (terminal) cysteines, which are capable of forming a disulfide bond with other components of the polymeric vehicle.
[00458] [00458] In a preferred embodiment, the polymeric carrier is formed by, comprises or consists of the peptide CysArg:2Cys (CRRRRRRRRRRRRC) (SEQ ID NO: 3046) or CysArgi (CRRRRRRRRRRR) (SEQ ID NO: 3047). Polymer Vehicles Comprising Non-Peptide Polymers
[00459] [00459] “According to a second alternative, at least one (poly-)cationic component of the polymeric carrier may be selected from, for example, any (poly-)cationic (non-peptidic) polymer suitable in this context, provided that this (poly-)cationic (non-peptidic) polymer exhibits or is modified to exhibit at least one —-SH moiety, which provides a disulfide bond linking the (poly-)cationic polymer with another component of the polymeric carrier as defined herein. Thus, as defined in this document, 'edition 870190141603, of 12/30/2019, p. 22267/22358 polymeric carrier may comprise the same or different (poly-)cationic polymers.
[00460] [00460] In the specific case that the cationic component of the polymeric vehicle comprises a (poly-)cationic (non-peptidic) polymer, the cationic properties of the (poly-)cationic (non-peptidic) polymer can be determined according to its content of cationic charges when compared to the general loads of the cationic polymer components. Preferably, the content of cationic charges in the cationic polymer at a (physiological) pH as defined in this document is at least 10%, 20% or 30%, preferably at least 40%, more preferably at least 50%, 60% or 70%, but also preferably at least 80%, 90%, or even 95%, 96%, 97%, 98%, 99% or 100%, more preferably at least 30%, 40%, 50%, 60% , 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100%, or it can be in the range of about 10% to 90%, more preferably in the range of about from 30% to 100%, still preferably in the range of about 50% to 100%, for example 50, 60, 70, 80%, 90% or 100%, or in a range formed by any two of the values mentioned above, provided that the content of all charges, eg positive and negative charges at a (physiological) pH, as defined herein, in the entire cationic polymer is 100%.
[00461] [00461] — Preferably, the cationic (non-peptidic) component of the polymeric carrier represents a (poly-)cationic polymer, typically exhibiting a molecular weight of about 0.1 or 0.5 kDa to about 100 kDa, preferably from about 1 kDa to about 75 kDa, more preferably from about 5 kDa to about 50 kDa, even more preferably from about 5 kDa to about 30 kDa, or a molecular weight of about 10 kDa to about 10 kDa 50 kDa, even more preferably from about 10 kDa to about 30 kDa. Additionally, the (poly-)cationic (non-peptidic) polymer typically exhibits at least 870190141603, 12/30/2019, pg. 22268/22358 nos a -SH moiety, which is capable of forming a disulfide bond upon condensation with other cationic components or other components of the polymeric vehicle as defined herein.
[00462] [00462] — In the above context, the cationic (non-peptidic) component of the polymer carrier can be selected from acrylates, modified acrylates such as pDMAEMA (poly(dimethylaminoethyl methylacrylate)), chitosans, aziridines or 2-ethyl-2- Oxazoline (forming oligo ethylenimines or modified oligoethylenimines), polymers obtained by reacting bisacrylates with amines forming oligo beta aminoesters or polyamide amines, or other polymers such as polyesters, polycarbonates, etc. Each molecule of these cationic or polycationic (non-peptidic) polymers typically exhibits at least one -SH moiety, wherein this at least one -SH moiety can be introduced into the cationic or polycationic (non-peptidic) polymer by chemical modifications, e.g. using monothiolane, 3-thio propionic acid or introduction of -SH moieties containing amino acids such as cysteine or any other (modified) amino acid. Such -SH moieties are preferably as defined above.
[00463] [00463] The disulfide crosslinked cationic components may be the same or different from each other. The polymeric carrier may also contain other components. It is also particularly preferred that the polymeric carrier used in accordance with the present invention comprises mixtures of peptides, proteins or cationic polymers and optionally further components, as defined herein, which are crosslinked by disulfide bonds as described herein. In this context, the disclosure of WO 2012/013326 is incorporated herein by reference.
[00464] [00464] In this context, the cationic components, which form the basis for the polymeric vehicle by disulfide crosslinking, are typically 'edition 870190141603, of 12/30/2019, p. 22269/22358 selected from any cationic or polycationic peptide, protein or polymer suitable for this purpose, any particular cationic or polycationic peptide, protein or polymer capable of complexing the artificial nucleic acid molecule, preferably RNA, of the invention and/or any other nucleic acid disclosed herein for use as described herein, and thus preferably condense said artificial nucleic acid and/or said other nucleic acid. The cationic or polycationic peptide, protein or polymer is preferably a linear molecule. However, branched cationic or polycationic peptides, proteins or polymers can also be used.
[00465] [00465] Each protein, peptide or cationic or polycationic polymer disulfide crosslinked from the polymeric carrier, which can be used to complex the artificial nucleic acid molecule, preferably RNA, of the invention and/or any other nucleic acid disclosed herein for use as described herein contains at least one —-SH moiety, more preferably at least one cysteine residue or any additional chemical group exhibiting an —-SH moiety, capable of forming a disulfide bond upon conversion. density with at least one additional cationic or polycationic protein, peptide or polymer as a cationic component of the polymeric carrier, as mentioned herein.
[00466] [00466] "As defined above, the polymeric carrier, which may be used to complex the artificial nucleic acid molecule, preferably RNA, of the invention and/or any other nucleic acid disclosed herein for use as described herein can be formed by cationic (or polycationic) components crosslinked by disulfide.
[00467] [00467] A complex of a nucleic acid, such as the artificial nucleic acid, preferably RNA, of the invention and/or any other publication 870190141603, of 12/30/2019, p. 22270/22358 Another nucleic acid disclosed herein for use as described herein, complexed with such polymeric carriers are also referred to herein as "polymeric carrier charge complexes". According to preferred embodiments, the artificial nucleic acid molecule, preferably RNA, of the invention or any other nucleic acid disclosed herein (preferably an isRNA, preferably comprising or consisting of an RNA sequence corresponding to SEQ ID NO : 2938 — 3032), may be provided in the form of a polymeric carrier charge complex, formed by a polymeric carrier, preferably comprising disulfide cross-linked cationic peptides, preferably Cys-Argi2 and/or Cys-Argi2-Cys, and said artificial nucleic acid molecule, preferably RNA, or said other nucleic acid.
[00468] [00468] According to other embodiments, the polymeric carrier can be selected from a polymeric carrier molecule according to the generic formula (CAT-II): LP!-S-[SP 2-S],-S- P3-L (CAT-II) in which P' and P3 are different or identical to each other and represent a linear or branched hydrophilic polymer chain, each P' and Pº exhibiting at least one -SH moiety, capable of forming a disulfide bond upon condensation with component P , or alternatively with (AA), (AA)', or [(AA) if such components are used as a linker between P and P or P and P ) and/or with other components (e.g. (AA), (AA)x, [(AA)x]: or L), linear hydrophilic polymer chain or branch selected independently of each other from polyethylene glycol (PEG), poly-N-(2-hydroxypropyl)methacrylamide, poly-2-(methacryloyloxy)ethyl phosphorylcholines, poly(hydroxyalkyl L-asparagine), poly(2-(methacryloyloxy)ethyl phosphorylcholine) , hydroxyethyl starch or poly(hydroxyethyl 870190141603, of 12/30/2019, page 22271/22358 xyalkyl L-glutamine), wherein the polymer chain exhibits a molecular weight of about 1 kDa to about from 100 kDa, preferably from about 2 kDa to about 25 kDa; or more preferably from about 2 kDa to about 10 kDa, for example, about 5 kDa to about 10 kDa or 5 kDa to about 10 kDa;
[00469] [00469] In this context, the disclosure of WO 2011/026641 is incorporated herein by reference. Each of the hydrophilic polymers P* and Pº typically exhibit at least one -SH moiety, wherein the at least one -SH moiety is capable of forming a disulfide bond upon reaction with component P or with component (AA) or (AA)x, if used as a linker between P and P or P and P as defined below and optionally with the additional component, eg L and/or (AA) or (AA)x, eg if two or more -SH moieties are contained. The following subformulas "P!-S-S-P " and "P -S-S-P*" within the generic formula (CAT-II) above (parentheses are omitted for readability), where any of S, P and P is as defined herein, typically represent a situation where a -SH moiety of hydrophilic polymers P* and P was condensed with a -SH portion of P component of generic formula (CAT-II) above, wherein both sulfurs of these -SH moieties form a -S-S- disulfide bond as defined herein in formula (CAT-II). These -SH moieties are typically provided by each of the hydrophilic polymers P and P3, for example, via an internal cysteine or any other (modified) amino acid or compound that carries an -SH moiety. Therefore, the subformula "P!-S-S-P " and "P -S-S-P " can also be written as "P!-Cys-Cys-P " and "P 2-Cys-Cys-Pº*", if the -SH moiety is provided by a cysteine, where the term Cys-Cys represents two cysteines coupled through a disulfide bond, not through a peptide bond . In this case, the term "-S-S-" in this formula can also be written as "-S-Cys", as "-Cys-S" or as "-Cys-Cys-". In this context, the term "-Cys-Cys-" does not represent a peptide bond, but a bond of two cysteines through their -SH moieties to form a disulfide bond. Therefore, the term "-Cys-Cys-" can also be understood from for- 'etition 870190141603, of 12/30/2019, p. 22274/22358 general as "-(Cys-S)-(S-Cys)-", where in this specific case S indicates the sulfur of the -SH portion of cysteine.
[00470] [00470] In some embodiments of the invention, the artificial nucleic acid molecule, preferably RNA (or said other nucleic acid) is associated with or complexed with a (poly-)cationic compound or a polymeric carrier, optionally in a weight ratio selected from a range of about 6:1 (w/w) to about 0.25:1 (w/w), more preferably from about 5:1 (w/w) to about 0.5:1 (w/w), even more preferably from about 4:1 (w/w) to about 1:1 (w/w) or from about 3:1 (w/w) to about 1:1 ( w/w), and more preferably a ratio of about 3:1 (w/w) to about 2:1 (w/w) of nucleic acid to (poly-)cationic compound and/or carrier polymeric; or optionally in a nitrogen/phosphate (N/P) ratio of nucleic acid to (poly-)cationic compound and/or polymeric carrier in the range of about 0.1 to 10, preferably in a range of about 0. 3 to 4 or 0.3 to 1, and more preferably in a range of about 0.5 to 1 or 0.7 to 1, and even more preferably in a range of about 0.3 to 0.9 or 0 .5 to 0.9. More preferably, the N/P ratio of issue 870190141603, of 12/30/2019, pg. 22276/22358 minus one artificial nucleic acid molecule, preferably RNA, for the one or more polycations is in the range of about 0.1 to 10, including a range of about 0.3 to 4, from about 0.5 to 2, from about 0.7 to 2 and from about 0.7 to 1.5.
[00471] [00471] The artificial nucleic acid molecule, preferably RNA, of the invention may also be associated with a vehicle, transfection agent or complexing to increase the transfection efficiency of said artificial nucleic acid molecule, preferably RNA . In this context, it is particularly preferred that the (pharmaceutical) composition of the invention comprises the artificial nucleic acid molecule, preferably RNA which is at least partially complexed with a (poly-)cationic compound and/or a polymeric carrier. , preferably cationic proteins or peptides. In this context, the disclosure of WO 2010/037539 and WO 2012/113513 is incorporated herein by reference. "Partially" means that only a part of said artificial nucleic acid molecule, preferably RNA, is complexed with a (poly)cationic compound and/or polymeric carrier, while the rest of said artificial nucleic acid molecule, preferably RNA is present in uncomplexed ("free") form.
[00472] [00472] — Preferably, the molar ratio of the complexed artificial nucleic acid molecule, preferably RNA to the free artificial nucleic acid molecule, preferably RNA is selected from a molar ratio of about 0.001:1 to about 1:0.001 , including a ratio of about 1:1. More preferably the ratio of complexed artificial nucleic acid molecule, preferably RNA to free artificial nucleic acid molecule, preferably RNA is selected from a range of about 5:1 (w/w) to about 1:10 (w/w) /w), more preferably in a range of about 4:1 (w/w) to about 1:8 (w/w), even more preferably in a range . 22277/22358 from about 3:1 (w/w) to about 1:5 (w/w) or 1:3 (w/w), and more preferably the ratio of complexed artificial nucleic acid molecule, preferably RNA to free artificial nucleic acid molecule, preferably RNA is selected from a ratio of about 1:1 (w/w).
[00473] [00473] The complexed artificial nucleic acid molecule, preferably RNA, of the invention is preferably prepared according to a first step by complexing an artificial nucleic acid molecule, preferably RNA with a (poly-)cationic compound and /or with a polymeric carrier, preferably as defined herein, in a specific ratio to form a stable complex. In this context, it is highly preferable, that no free (poly-)cationic compound or polymeric carrier or only a small insignificant amount thereof remains in the fraction of the complexed artificial nucleic acid molecule, preferably RNA after complexation of said acid molecule. artificial nucleic, preferably RNA. Therefore, the ratio of the artificial nucleic acid molecule, preferably RNA, and the (poly-)cationic compound and/or the polymeric carrier in the complexed RNA fraction is typically selected in a range such that the artificial nucleic acid molecule, preferably RNA is fully complexed and no (poly-)cationic compound or free polymeric carrier or only an insignificant small amount of the same remains in said fraction.
[00474] [00474] — Preferably, the ratio of the artificial nucleic acid molecule, preferably RNA, to the (poly-)cationic compound and/or polymeric carrier, preferably as defined herein, is selected from a range of about from 6:1 (w/w) to about 0.25:1 (w/w), more preferably from about 5:1 (w/w) to about 0.5:1 (w/w), even more preferably from about 4:1 (w/w) to about 870190141603, 12/30/2019, pg. 22278/22358 from 1:1 (w/w) or from about 3:1 (w/w) to about 1:1 (w/w), and more preferably a ratio of about 3:1 ( w/w) to about 2:1 (w/w).
[00475] [00475] —Alternatively, the ratio of the artificial nucleic acid molecule, preferably RNA, to the (poly-)cationic compound and/or polymeric carrier can also be calculated based on the nitrogen/phosphate ratio (N/P ratio) of the entire complex. In the context of the present invention, an N/P ratio is preferably in the range of about 0.1 to 10, preferably in the range of about 0.3 to 4 and more preferably in the range of about 0.5 a 20u 0.7 to 2 with respect to the ratio of the artificial nucleic acid molecule, preferably RNA, to (poly-)cationic compound and/or polymeric carrier, preferably as defined herein, in the complex, and more preferably in a range of about 0.7 to 1.5, 0.5 to 1 or 0.7 to 1, and even more preferably in a range of about 0.3 to 0.9 or 0.5 to 0.9, preferably provided that the (poly-)cationic compound in the complex is the (poly-)cationic protein or peptide and/or the polymeric carrier as defined above.
[00476] [00476] In other embodiments, the artificial nucleic acid molecule, preferably RNA, can be provided and used in the free or naked form without being associated with any other vehicle, transfection agent or complexing. Composition (Pharmaceuticals)
[00477] [00477] In another aspect, the present invention provides a composition comprising the artificial nucleic acid molecule, preferably RNA, according to the invention, and at least one pharmaceutically acceptable carrier and/or excipient. The composition according to the invention is preferably provided as a pharmaceutical composition or as a vaccine.
[00478] [00478] "Vaccine" is typically understood to be a prophylactic or therapeutic material providing at least one antigen, preference 870190141603, 12/30/2019, pg. 22279/22358 cially an antigenic protein or peptide. "Providing at least one antigen" means, for example, that the vaccine comprises the antigen or that the vaccine comprises the molecule that, for example, encodes the antigen.
[00479] [00479] The (pharmaceutical) composition or vaccine according to the invention comprises at least one artificial nucleic acid molecule, preferably RNA, comprising at least one coding sequence encoding an antigenic protein or peptide. Said antigenic protein or peptide may preferably be derived from a tumor antigen, a bacterial, viral, fungal or protozoal antigen, a self-antigen, an allergen, or an allogeneic antigen. Its expression and presentation to the immune system can preferentially induce an immune response to the tumor antigen, or to the bacterial, viral, fungal or protozoal antigen, or it can induce tolerance to the autoantigen, allergen or allogeneic antigen.
[00480] [00480] The (pharmaceutical) composition or vaccines of the invention preferably comprise at least one, preferably a plurality of at least two artificial nucleic acid molecules, preferably RNAs, as described herein. Said plurality of at least two artificial nucleic acid molecules, preferably RNAs, may be monocistronic, bicistronic or multicistronic as described herein.
[00481] [00481] Each of the artificial nucleic acid molecules, preferably RNAs, of the (pharmaceutical) composition or vaccine of the invention may encode at least one, or a plurality of at least two (identical or different) antigenic fusion proteins as defined in this document. "Different" artificial nucleic acid species in a pharmaceutical composition may encode "different" amino acid sequences derived from IRSTepm, "different" 'edition 870190141603, 12/30/2019, p. 22280/22358 signal peptides, "different" T helper epitopes, "different" ligands, or preferably "different" antigenic peptides or proteins"
[00482] [00482] Therefore, in some embodiments of the invention, the (pharmaceutical) composition or vaccine of the invention comprises a plurality of at least two artificial nucleic acid molecules, preferably RNAs, as described herein, wherein preferably at least two of said plurality of artificial nucleic acid molecules encode a different antigenic protein or peptide, preferably as described herein, or a fragment, variant or derivative thereof.
[00483] [00483] The (pharmaceutical) composition or vaccine of the invention may further comprise at least one excipient, vehicle, adjuvant or other pharmaceutically acceptable component (e.g., additional active agents, and the like), as described herein. Pharmaceutically acceptable excipients and vehicles
[00484] [00484] - Preferably, the (pharmaceutical) composition according to the invention comprises at least one pharmaceutically acceptable carrier and/or excipient. The term "pharmaceutically acceptable" refers to a compound or agent that is compatible with the one or more active agent(s) (here: artificial nucleic acid molecule, preferably RNA) and does not interfere with and/or or substantially reduces its pharmaceutical activities. Pharmaceutically acceptable carriers and/or excipients preferably have sufficiently high purity and sufficiently low toxicity to make them suitable for administration to a subject to be treated. excipients
[00485] [00485] *Pharmaceutically acceptable excipients may exhibit different functional roles and include, without limitation, diluents, fillers, bulking agents, vehicles, disintegrants, binders, lubricating agents 870190141603, dated 12/30/2019, pg. 22281/22358 agents, glidants, coatings, solvents and co-solvents, buffering agents, preservatives, adjuvants, antioxidants, wetting agents, anti-foaming agents, thickening agents, sweetening agents, flavoring and wetting agents.
[00486] [00486] For (pharmaceutical) compositions in liquid form, useful pharmaceutically acceptable excipients in general include solvents, diluents, or carriers such as (pyrogen-free water), (isotonic) saline solutions such as phosphate or citra buffered saline solutions. - to, fixed oils, vegetable oils such as, for example, peanut oil, cottonseed oil, sesame oil, olive oil, corn oil, ethanol, polyols (e.g. glycerol, propylene glycol, polyethylene glycol, and the like); lecithin; surfactants; preservatives such as benzyl alcohol, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like; isotonic agents such as sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride; aluminum monostearate or gelatin; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid (EDTA); buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. The pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. Buffers may be hypertonic, isotonic or hypotonic with reference to the specific reference medium, that is, the buffer may have a higher, identical, or lower salt content with reference to the specific reference medium, in which preferably such concentrations of the aforementioned salts can be used, which do not lead to cell damage due to osmosis or other concentration effects. Reference media are, for example, liquids occurring in "in vivo" methods, such as blood, lymph, cytosolic fluids, or other body fluids, or for example liquids, which can be used as reference media in "in vitro" methods, such as 'edition 870190141603, of 12/30/2019, p. 22282/22358 buffers or common liquids. Such buffers or common liquids are known to one skilled in the art. Lactate Ringer's solution is particularly preferred over a liquid base.
[00487] [00487] For (pharmaceutical) compositions in (semi-)solid form, useful pharmaceutically acceptable excipients include binders such as microcrystalline cellulose, gum tragacanth or gelatin; starch or lactose; sugars such as, for example, lactose, glucose and sucrose; starches, such as, for example, corn starch or potato starch; cellulose and its derivatives, such as, for example, sodium carboxymethyl cellulose, ethyl cellulose, cellulose acetate; disintegrants such as alginic acid; lubricants such as magnesium stearate; glidants such as stearic acid, magnesium stearate; calcium sulfate, colloidal silicon dioxide and the like; sweetening agents such as sucrose or saccharin; and/or flavoring agents such as peppermint, methyl salicylate, or orange flavoring. vehicles
[00488] [00488] Suitable pharmaceutically acceptable carriers are typically chosen based on the formulation of the (pharmaceutical) composition.
[00489] [00489] “Liquid (pharmaceutical) compositions administered via injection and in particular via i.v. injection must be sterile and stable under the conditions of manufacture and storage. Such compositions are typically formulated as parenterally acceptable aqueous solutions that are pyrogen-free, have adequate pH, are isotonic, and maintain stability of the active ingredient(s).
[00490] [00490] Particularly useful pharmaceutically acceptable carriers for liquid (pharmaceutical) compositions according to the invention include water, typically pyrogen-free water; isotonic or buffered (aqueous) saline solution, eg phosphate, citrate, etc. buffered solutions. Particularly for injection of compositions 'edition 870190141603, of 12/30/2019, p. 22283/22358
[00491] [00491] “According to preferred embodiments, the sodium, calcium and, optionally, potassium salts may occur in the form of their halides, for example, chlorides, iodides, or bromides, in the form of their hydroxides, carbonates, hydrogen carbonates, or sulfates, etc. Without being limited thereto, examples of sodium salts include, for example, NaCl, Nal, NaBr, Na2 CO3 , NaHCO3 , Na2 SO4 , examples of the optional potassium salts include, for example, KCl, KI, KBr, K2 CO3 , KHCO; 3, K2SOa.a, and examples of calcium salts include, for example, CaCl2, Cala, CaBr2, CaCOz3, CaSO4, Ca(OH)2. Furthermore, organic anions of the aforementioned cations may be contained in the buffer.
[00492] [00492] According to more preferred embodiments, the buffer suitable for injection purposes as defined above may contain salts selected from sodium chloride (NaCl), calcium chloride (CaCl2) and optionally potassium chloride (KCl), where still anions may be present in addition to chlorides. CaCl2 can also be replaced by another salt such as KCl. Typically, the salts in the injection buffer are present in a concentration of at least 50 mM sodium chloride (NaCl), at least 3 mM potassium chloride (KCI), and at least 0.01 mM calcium chloride (CaCl2) . The injection buffer may be hypertonic, isotonic or hypotonic with reference to the specific reference medium, i.e. the buffer may have a higher, identical or lower salt content with reference to the specific reference medium, where preferably such concentrations of salts 'edition 870190141603, of 12/30/2019, p. 22284/22358 mentioned above can be used, which do not lead to cell damage due to osmosis or other concentration effects. Reference media are, for example, in "in vivo" methods occurring liquids such as blood, lymph, cytosolic fluids or other body fluids, or for example liquids, which can be used as a reference medium in "reference" methods. in vitro", such as buffers or common liquids. Such buffers or common liquids are known to one skilled in the art. Lactate Ringer's solution is particularly preferred as a liquid base. Complexation
[00493] [00493] The artificial nucleic acid molecule, preferably RNA, of the invention, and/or optionally any other nucleic acid, forming part of the (pharmaceutical) composition or vaccine of the invention may be provided in "complexed" or "naked" form as described elsewhere in this document, or a mixture thereof.
[00494] [00494] According to preferred embodiments, the artificial nucleic acid molecule(s), preferably RNA(s), of the (pharmaceutical) or vaccine composition of the invention, or any other nucleic acid disclosed herein, is/are complexed with one or more cationic or polycationic compounds, preferably with cationic or polycationic polymers, cationic or polycationic peptides or proteins, for example protamine, cationic or polycationic polysaccharides and/or cationic or polycationic lipids.
[00495] [00495] Means and methods for providing "complexed" molecules of artificial nucleic acid, preferably RNAs, are described in the section entitled "Complexation" and are equally applicable to the composition(s) (pharmaceutical(s)) and vaccines of the invention, mutatis mutandis. Specifically, the artificial nucleic acid molecule(s), preferably RNA(s), and/or optionally any other nucleic acid, forming part of the (pharmaceutical) or vaccine composition of the invention 'edition 870190141603, of 12/30/2019 , p. 22285/22358 can be complexed with lipids, (poly-)cationic compounds and carriers, preferably selected from cationic (poly-)amino acids, peptides and proteins, (poly-)cationic polysaccharides, (cationic polylipids , (poly-)cationic polymers, or polymeric carriers as described above.
[00496] [00496] According to preferred embodiments, the artificial nucleic acid molecule(s), preferably RNA(s), and/or optionally any other nucleic acid, forming part of the (pharmaceutical) composition or vaccine of the invention may be complexed with a polymeric vehicle formed by disulfide-crosslinked cationic components, preferably disulfide-crosslinked cationic peptides, preferably comprising peptides according to the formula (CAT-I), (CAT-la) and/or (CAT-Ib) and/or a compound according to formula (Cat-II) (LP*-S-[SP -S]hSP -L) as described above. Formulation
[00497] [00497] In general, (pharmaceutical) compositions for topical administration can be formulated as creams, ointments, gels, pastes or powders. (Pharmaceutical) compositions for oral administration may be formulated as tablets, capsules, liquids, powders or in a sustained release format. However, in accordance with preferred embodiments, the (pharmaceutical) composition of the invention is administered parenterally, in particular via intradermal or intramuscular injection, and is therefore formulated in liquid or lyophilized form for parenteral administration as discussed to any place in this document. Parenteral formulations are typically stored in vials, IV bags, ampoules, cartridges, or pre-filled syringes and can be administered as injections, inhalants, or aerosols, with injections being preferred. Lyophilized formulations
[00498] [00498] “In further preferred embodiments, the composition (pharmaceutical formulation 870190141603, 12/30/2019, p. 22286/22358) or vaccine is provided in lyophilized form. Preferably, the lyophilized (pharmaceutical) composition or vaccine is reconstituted in a suitable buffer, advantageously on the basis of an aqueous vehicle, prior to administration, e.g. Lactate Ringer's solution, which is preferred, Ringer's solution, a phosphatic buffer solution, - fact. In some embodiments, the (pharmaceutical) composition according to the invention contains at least two, three, four, five, six or more molecules of artificial nucleic acid, preferably RNAs, which are provided separately in lyophilized form (optionally together with at least one additional additive) and which are preferably reconstituted separately in a suitable buffer (such as Lactate Ringer's solution) prior to use so as to allow individual administration of each of said artificial nucleic acid molecule , preferably RNAs. liquid formulations
[00499] [00499] In further preferred embodiments, a (pharmaceutical) composition is provided in the form of a saline or lipid based formulation. Lipid based formulations may comprise liposomes, lipoplexes, nanoliposomes and lipid nanoparticles which are described above in the section entitled "Complexation". adjuvants
[00500] [00500] According to other embodiments, the (pharmaceutical) composition or vaccine of the invention may further comprise at least one adjuvant.
[00501] [00501] — An "adjuvant" or "adjuvant component" in the broadest sense is typically a pharmacological and/or immunological agent that can modify, for example, enhance, the effect of other active agents, for example, therapeutic agents or vaccines. In this context, an "adjuvant" can be considered any compound, which is suitable for administration and delivery in support of the composition 'edition 870190141603, of 12/30/2019, p. 22287/22358 according to the invention. Specifically, an adjuvant may preferably enhance the immunostimulatory properties of the (pharmaceutical) composition or vaccine to which it is added. Furthermore, such adjuvants may, without being bound thereto, initiate or enhance an immune response of the innate immune system, that is, the non-specific immune response.
[00502] [00502] —“Adjuvants” typically do not induce an adaptive immune response. Insofar as “adjuvants” do not qualify as antigens. In other words, when administered, the (pharmaceutical) composition or vaccine of the invention typically initiates an adaptive immune response due to an antigenic peptide or protein, which is encoded by at least one artificial nucleic acid molecule coding sequence, preferably RNA, contained in said (pharmaceutical) composition or vaccine. Additionally, an adjuvant present in the composition (pharmaceutical) or vaccine can generate an innate (sympathetic) immune response.
[00503] [00503] —Suitable adjuvants may be selected from any adjuvant known to a person skilled in the art and suitable for the present case, i.e., supporting the induction of an immune response in a mammal, and includes, without limitation, TOM, MDP, Muramyl Dipeptide, Pluronics, Alum Solution, Aluminum Hydroxide, ADJUMERTY (polyphosphazene); aluminum phosphate gel; algae glucans; algamulin; aluminum hydroxide gel (alum); highly protein adsorbing aluminum hydroxide gel; low viscosity aluminum hydroxide gel; AF or SPT (squalane emulsion (5%), Tween 80 (0.2%), Pluronic L121 (1.25%), phosphate buffered saline, pH 7.4); AVRIDINE!Y (propanediamine); BAY R1005'"M — ((hydroacetate — from — N-(2-deoxy-2-L-leucylamino-bD-glucopyranosyl)-N-octadecyl-dodecanoyl-amide); — CALCITRIOL'M =“ (1- alpha, 25-dihydroxy-vitamin D3); calcium phosphate gel; CAPTY (nano-ethion 870190141603, dated 12/30/2019, page 22288/22358 calcium phosphate particles); cholera holotoxin, fusion protein from the fragment cholera-toxin-A1-protein-AD, subunit B of cholera toxin; CRL 1005 (copolymer in P1205); liposomes containing cytokine; DDA (dimethyldioctadecylammonium bromide); DHEA (dehydroepiandrosterone); DMPC (dimyristoylphosphatidylcholine); ); DMPG (dimyristoylphosphatidylglycerol); DOC / alum complex (sodium salt of deoxycholic acid); Freun's complete adjuvant; Freun's incomplete adjuvant; gamma inulin; Gerbu adjuvant (mixture of: i) N-acetylglucosaminyl-( P1-4)-N-acetylmuramyl-L-alanyl-D-glutamine (GMDP), ii) dimethyl-dioctadecylammonium chloride (DDA), iii) zinc-L-proline salt complex (ZnPro-8); GM- CSF); GMDP (N-acetylgluc osaminyl-(b1-4)-N-acetylmuramil-L-alanyl-D-isoglutamine); imiquimod (1-(2-methypropyl)-1H-imidazo[4,5-c]quinoline-4-amine); ImmTher"Y (N-acetylglucosaminyl-N-acetylmuramyl-L-Ala-D-isoGlu-L-Ala-glycerol dipalmitate);) DRVs (immunoliposomes prepared from dehydration-rehydration vesicles); interferon-gamma; interleukin -1beta; interleukin-2; interleukin-7; interleukin-12; ISCOMSTY; ISCOPREP 7.0.3."”; liposomes; LOXORIBINETY (7-allyl-8-oxoguanosine); oral LT adjuvant (E. coli enterotoxin-labile protoxin); microspheres and microparticles of any composition; MF59TY; (squalene-water emulsion); MONTANIDE ISA 517Y (Freund's incomplete purified adjuvant); MONTANIDE ISA 720'Y (metabolizable oil adjuvant); MPL'VY (3-Q-desacyl-4"-monophosphoryl lipid A); MTP-PE and MTP-PE liposomes ((N-acetyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1,2 -dipalmitoyl-sn-glycero-3-(hydroxyphosphoryloxy))-ethylamide, monosodium salt); MURAMETIDETY (Nac-Mur-L-Ala-D-GIn-OCH3); MU-RAPALMITINE!Y and D-MURAPALMITINET!Y (Nac -Mur-L-Thr-D-isoGln- sn-glyceroldipalmitoyl); NAGO (neuraminidase-galactose oxidase); nanospheres or nanoparticles of any composition; NISVs (non-ionic surfactant vesicles); PLEURANTY (B-glucan) ; PLGA, PGA and PLA (homo- and copolymers of lactic acid and glycolic acid; microsphere 870190141603, of 12/30/2019, page 22289/22358 ras/nanospheres); PLURONIC L1217Y; PMMA (polymethylmethacrylate); PODDSTY (proteinoid microspheres); polyethylene carbamate derivatives; poly-rA: poly-rU (polyadenylic acid-polyuridylic acid complex); polysorbate 80 (Tween 80); cochlear protein (Avanti Polar Lipids, Inc. , Alabaster, AL); STIMULONTY (QS-21); Quil-A (Quil-A saponin); S8-28463 ( 4-amino-otec-dimethyl-2-ethoxymethyl-1H-imidazo[4,5-cycloline-1-ethanol); SAF-1"Y ("Syntex Adjuvant Formulation"); Sendai proteoliposomes and lipid matrices containing Sendai; Span-85 (sorbitan trioleate); Specol (Marcol 52, Span 85 and Tween 85 emulsion); squalene or RobaneO ( 2,6,10,15,19,23-hexamethyltetracosane and 2,6,10,15,19,23-hexamethyl-2,6,10,14,18,22-tetracosahexane); stearyltyrosine (octadecyltyrosine hydrochloride ); Theramid™ (N-acetylglucosaminyl-N-acetylmuramyl-L-Ala-D-isoGlu-L-Ala-dipalmitoxypropylamide-
[00504] [00504] — Suitable adjuvants may also be selected from (poly-)cationic compounds as described herein as complexing agents (see section "directed complexing"), in particular, (poly-)cationic, polysaccharide, peptides or proteins (poly-)cationic, (poly-)cationic lipids, or polymeric carriers described herein. The association or complexation of the artificial nucleic acid molecule of the (pharmaceutical) composition or vaccine with (poly-)cationic compounds, as defined, may preferentially provide adjuvant properties and confer a stabilizing effect.
[00505] [00505] The ratio of the artificial nucleic acid molecule, preferably RNA, to the (poly-)cationic compound in the adjuvant component can be calculated based on the nitrogen/phosphate ratio (N/P ratio) of the whole complex, i.e. the ratio of positively charged (nitrogen) atoms of the (poly-)cationic compound to the negatively charged phosphate atoms of the artificial nucleic acid molecule, preferably RNA.
[00506] [00506] Below, when referring to "RNA", it will be understood that the respective description is also applicable to other artificial nucleic acid molecules, mutatis mutandis.
[00507] [00507] — For example, 1ug of RNA can contain about 3 nmoles of phosphate residues, provided that said RNA has a statistical distribution of bases. Additionally, 1 ug of peptide typically contains about x nmol of nitrogen residues, depending on molecular weight and number of basic amino acids. When exemplarily calculated for (Arg)s (molecular weight 1424g/mol, 9 nitrogen atoms), 11ug (Arg)s contains about 700pmo!l (Arg)s and thus 700 x 9=6300pmoles of basic amino acids = 6, 3nmoles of 'edition 870190141603, of 12/30/2019, p. 22291/22358 nitrogen atoms. For a mass ratio of about 1:1 RNA/(Arg)s, an N/P ratio of about 2 can be calculated. When exemplary calculated for protamine (molecular weight of about 4250g/mol, 21 nitrogen atoms, when salmon protamine is used) with a mass ratio of about 2:1 with 2ug of RNA, 6nmol of phosphate should be calculated for the RNA; 1ug of protamine contains about 235pmol of protamine molecules and thus 235 x 21 = 4935pmol of basic nitrogen atoms = 4.9nmol of nitrogen atoms. For a mass ratio of about 2:1 RNA/protamine, an N/P ratio of about 0.81 can be calculated. For a mass ratio of about 8:1 RNA/protamine, an N/P ratio of about 0.2 can be calculated. In the context of the present invention, an N/P ratio is preferably in the range of about 0.1-10, preferably in the range of about 0.3-4 and more preferably in the range of about 0.5-2 or 0.7-2 with respect to the RNA:peptide ratio in the complex and more preferably in the range of about 0.7-1.5.
[00508] [00508] The (pharmaceutical) composition or vaccine of the present invention can be obtained in two separate steps in order to obtain both an efficient immunostimulatory effect and efficient translation of the artificial nucleic acid molecule, preferably RNA, contained in the reaction. - wound composition (pharmaceutical) or vaccine.
[00509] [00509] In a first step, an RNA is complexed with a (poly-)cationic compound at a specific ratio to form a stable complex ("complexed RNA"). In this context, it is important that no free (poly-)cationic compounds or only a very small amount remain in the complexed RNA fraction. Therefore, the ratio of the RNA to the (poly-)cationic compound is typically selected in a range that the RNA is fully complexed and no free (poly-)cationic compound or only a very 'ethion 870190141603' amount of 12/30/2019, page 22292/22358 small remains in the composition. Preferably, the ratio of RNA to (poly-)cationic compound is selected from a range of about 6:1 (w/w) to about 0.25:1 (w/w), more preferably from about 5 :1 (w/w) to about 0.5:1 (w/w), even more preferably from about 4:1 (w/w) to about 1:1 (w/w) or from about 3:1 (w/w) to about 1:1 (w/w), and more preferably a ratio of about 3:1 (w/w) to about 2:1 (w/w).
[00510] [00510] In a second step, an RNA is added to the complexed RNA in order to obtain the (pharmaceutical) composition or vaccine of the invention. There, said added RNA is present as free RNA, preferably as free mMRNA, which is not complexed by other compounds. Prior to addition, free RNA is not complexed and will preferably not undergo any detectable or significant complexation reaction upon addition to complexed RNA. This is due to the strong binding of the (poly-)cationic compound with the complexed RNA. In other words, when free RNA is added to complexed RNA, preferably no free or substantially free (poly-)cationic compound is present, which could form a complex with said free RNA. Therefore, the free RNA of the (pharmaceutical) composition or vaccine of the invention can be efficiently transcribed in vivo.
[00511] [00511] It may be preferred that the free RNA may be identical or different from the complexed RNA, depending on the specific therapy requirements. Even more preferably, the free RNA, which is contained in the combination, composition (pharmaceutical) or vaccine of the invention, is identical to the complexed RNA, in other words, the combination, composition (pharmaceutical) or vaccine comprises an RNA otherwise identical in both free and complexed forms.
[00512] [00512] In particularly preferred embodiments, the (pharmaceutical) composition or vaccine of the invention thus comprises the RNA as 'edition 870190141603, of 12/30/2019, p. 22293/22358 defined herein, wherein said RNA is present in said (pharmaceutical) or vaccine composition partially as free RNA and partially as complexed RNA. Preferably, the RNA as defined herein, preferably an mRNA, is complexed as described above and the same (mM)RNA is then added in the form of free RNA, where preferably the compound, which is used to complex the Epitope-coding RNA is not present in free form in the composition at the time of addition of free RNA.
[00513] [00513] The ratio of complexed RNA to free RNA can be selected depending on the specific requirements of a particular therapy. Typically, the ratio of complexed RNA to free RNA is selected such that significant stimulation of the innate immune system is triggered due to the presence of the complexed RNA. In parallel, the ratio is selected such that a significant amount of free RNA can be provided in vivo leading to an efficient concentration and translation of the antigenic fusion protein expressed in vivo. Preferably, the ratio of complexed RNA to free RNA in the (pharmaceutical) composition or vaccine of the invention is selected from a range of about 5:1 (w/w) to about 1:10 (w/w). , more preferably in a range of about 4:1 (w/w) to about 1:8 (w/w), even more preferably in a range of about 3:1 (w/w) to about of 1:5 (w/w) or 1:3 (w/w), and more preferably about 1:1 (w/w).
[00514] [00514] — Additionally or alternatively, the ratio of complexed RNA to free RNA can be calculated based on the nitrogen/phosphate ratio (N/P ratio) of the entire RNA complex. In the context of the present invention, an N/P ratio is preferably in the range of about 0.1-10, preferably in the range of about 0.3-4 and more preferably in the range of about 0.5-2 or 0.7-2 in relation to the RNA:peptide ratio in the complex, and more preferably - 'ethition 870190141603, of 12/30/2019, p. 22294/22358 is in the range of about 0.7-1.5.
[00515] [00515] — Additionally or alternatively, the ratio of complexed RNA and free RNA can also be selected based on the molar ratio of both RNAs to each other. Typically, the molar ratio of complexed RNA to free RNA can be selected such that the molar ratio satisfies the definitions of N/P and/or (w/w) above. More preferably, the molar ratio of complexed RNA to free RNA can be selected, for example, from a molar ratio of about 0.001:1, 0.01:1, 0.1:1, 0.2:1 , 0.3:1, 0.4:1, 0.5:1, 0.6:1, 0.7:1, 0.8:1, 0.9:1, 1:1, 1:0 .9, 1:0.8, 1:0.7, 1:0.6, 1:0.5, 1:0.4, 1:0.3, 1:0.2, 1:0.1 , 1:0.01, 1:0.001 etc. or any range formed by any two of the above values, for example a selected range from about 0.001:1 to 1:0.001, including a range from about 0.01:1 to 1:0.001, 0.1:1 to 1:0.001, 0.2:1 to 1:0.001, 0.3:1 to 1:0.001, 0.4:1 to 1:0.001, 0.5:1 to 1:0.001, 0.6:1 to 1:0.001, 0.7:1 to 1:0.001, 0.8:1 to 1:0.001, 0.9:1 to 1:0.001, 1:1 to 1:0.001, 1:0.9 to 1 :0.001, 1:0.8 to 1:0.001, 1:07 to 1:0.001, 1:0.6 to 1:0.001, 1:0.5 to 1:0.001, 1:0.4 to 1:0.001 , 1:03 to 1:0.001, 1:0.2 to 1:0.001, 1:0.1 to 1:0.001, 1:0.01 to 1:0.001, or a range of about 0.01 :1 to 1:0.01, 0.1:1 to 1:0.01, 0.2:1 to 1:0.01, 0.3:1 to 1:0.01, 0.4:1 to 1:0.01, 0.5:1 to 1:0.01, 0.6:1 to 1:0.01, 0.7:1 to 1:0.01, 0.8:1 to 1 :0.01, 0.9:1 to 1:0.01, 1:1 to 1:0.01, 1:0.9 to 1:0.01, 1:08 to 1:0.01, 1 :0.7 to 1:0.01, 1:0.6 to 1:0.01, 1:0.5 to 1:0.01, 1:0.4 to 1:0.01, 1:0 .3 to 1:0.01, 1:0.2 to 1:0.01, 1:0.1 to 1:0.01, 1:0.01 to 1:0.01, or including a range from about 0.001:1 to 1:0.01, 0.001:1 to 1:0.1, 0.001:1 to 1:0.2, 0.001:1 to 1:0.3, 0.001:1 to 1: 0.4, 0.001:1 to 1:0.5, 0.001:1 to 1:06, 0.001:1 to 1:0.7, 0.001:1 to 1:0.8, 0.001:1 to 1:0, 9, 0.001:1 to 1:1, 0.001 to 0.9:1, 0.001 to 0.8:1, 0.001 to 0.7:1, 0.001 to 0.6:1, 0.001 to 0.5:1, 0.001 to 0.4:1, 0.001 to 0.3:1, 0.001 to 0.2:1, 0.001 to 0.1:1, or a range of about 0.01:1 to 1:0.01, 0.01:1 to 1:0.1, 0.01:1 to 1:0.2, 0.01:1 to 1:0.3, 0.01:1 to 1:0.4, 0, 01:1 to 1:0.5, 0.01:1 to 1:0.6, 0.01:1 to 1:0.7, 0.01:1 to 'edition 870190141603, of 12/30/2019 , p. 22295/22358
[00516] [00516] Even more preferably, the molar ratio of complexed RNA to free RNA can be selected, for example, from a range of about 0.01:1 to 1:0.01. more preferably, the molar ratio of complexed RNA to free RNA may be selected, for example, from a molar ratio of about 1:1. Any of the above definitions regarding N/P and/or (p/p) ratio may also apply.
[00517] [00517] According to preferred embodiments, the (pharmaceutical) composition or vaccine comprises another nucleic acid, preferably as an adjuvant.
[00518] [00518] — Therefore, the (pharmaceutical) composition or vaccine of the invention further comprises a non-coding nucleic acid, preferably RNA, selected from the group consisting of small interference RNA (siRNA), antisense RNA (asRNA) , circular RNA (circRNA), ribozymes, aptamers, riboswitches, immunostimulating RNA (iSRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), micro-CcroRNA ( miRNA), and Piwi-interacting RNA (piRNA).
[00519] [00519] In the context of the present invention, non-coding nucleic acids, preferably RNAs, of particular interest include "immunostimulatory" or "is" nucleic acids, preferably RNAs. "Immunostimulatory" or "Is" nucleic acids or RNAs are typically employed as adjuvants in the (pharmaceutical) composition or vaccine according to the invention.
[00520] [00520] According to a particularly preferred embodiment, the nucleic acid adjuvant comprises the nucleic acid of the following Formula (IS-1) or (IS-II): 'edition 870190141603, of 12/30/2019, p. 22296/22358
[00521] [00521] Nucleic acids of formula (IS-I) or (IS-IIl) that can be used as isRNA can be relatively short nucleic acid molecules with a typical length of approximately 5 to 100 (but can also be be longer than 100 nucleotides for specific embodiments, e.g. up to 200 nucleotides), from 5 to 90 or from 5 to 80 nucleotides, preferably a length of approximately 5 to 70, more preferably a length of approximately 8 to 60 and more preferably a length of approximately from 15 to 60 nucleotides, more preferably from 20 to 60, most preferably from 30 to 60 nucleotides. If the isRNA has a maximum length of, for example, 100 nucleotides, m will typically be < 98.
[00522] [00522] The number of "G" nucleotides in the (IS-I) nucleic acid is determined by | or not l and n, independently of one another, are each an integer from 1 to 40, wherein when loun=1G is a nucleotide comprising guanine or an analogue thereof, and when | or n > 1 at least 50% of the nucleotides comprise guanine, or an analogue thereof.
[00523] [00523] For example, without implying any limitation, when | or n = 4, Gl or Gn can be, for example, GUGU, GGUU, UGUG, UUGG, GUUG, GGGU, GGUG, GUGG, UGGG or GGGG etc.; when | or n = 5, GI or Gn can be, for example, GGGUU, GGUGU, GUGGU, UG-GGU, UGGUG, UGUGG, UUGGG, GUGUG, GGGGU, GGGUG, GGUGG, GUGGG, UGGGG or GGGGG etc.; etc.
[00524] [00524] A nucleotide adjacent to Xm in the formula nucleic acid (IS-I) preferably does not comprise uracil.
[00525] [00525] Likewise, the number of "C" nucleotides in the nucleic acid of formula (IS-lIl) is determined by | or not l and n, independently of each other, are each an integer from 1 to 40, where when | or n = 1 C is a nucleotide comprising cytosine or an analogue thereof, and when | or n > 1, at least 50% of the nucleotides comprise cytosine or an analogue thereof.
[00526] [00526] “For example, without implying any limitation, when | or n = 4, Cl or Cn may be, for example, CUCU, CCUU, UCUC, UUCC, CUUC, CCCU, CCUC, CUCC, UCCC or CCCC etc.; when | or n = 5, Cl or Cn can be, for example, CCCUU, CCUCU, CUCCU, UC-CCU, UCCOUC, UCUCC, UUCCC, CUCUC, CCCCU, CCCOUC, CCUCC, CUCCC, UCCOCC, or CCCCC etc.
[00527] [00527] A nucleotide adjacent to Xm in the formula nucleic acid (IS-II) preferably does not comprise uracil. Preferably, for the formula (IS-I), when | or n > 1, at least 60%, 70%, 80%, 90% or even 100% of the nucleotides comprise guanine or an ethition 870190141603, of 12/30/2019, p. 22299/22358 analogue thereof, as defined above.
[00528] [00528] The nucleotides remaining for 100% (when nucleotides comprising guanine constitute less than 100% of the nucleotides) in the G1 and/or Gn flanking sequences are uridine or an analogue thereof, as defined above. Still preferably, | and n, independently of one another, are each an integer from 2 to 30, more preferably an integer from 2 to 20 and even more preferably an integer from 2 to 15. The lower limit of | or n may vary if necessary and is at least 1, preferably at least 2, more preferably at least 3, 4,5,6,7,8,9 or 10. This definition correspondingly applies to formula (IS-II).
[00529] [00529] "According to another preferred embodiment, the isRNA as described herein consists of or comprises a nucleic acid of formula (IS-IlI) or (IS-IV): (NuGIXmGnNy)a (IS-I) in which: G is a nucleotide comprising guanine, uracil or an analogue of guanine or uracil, preferably comprising guanine or an analogue thereof; X is a nucleotide comprising guanine, uracil, adenine, thymine, cytosine, or an analogue thereof, preferably comprising uracil or an analogue thereof; N is a nucleic acid sequence having a length of from about 4 to 50, preferably from about 4 to 40, more preferably from about 4 to 30 or 4 to 20 nucleic acids, each N being independently selected from a nucleotide comprising guanine, uracil, adenine, thymine, cytosine or an analogue thereof; a is an integer from 1 to 20, preferably from 1 to 870190141603, of 12/30/2019, p. 22300/22358
[00530] [00530] For formula (IS-IV), any of the definitions provided above for the elements N (i.e. Nu and N,) and X (Xm), particularly the core structure as defined above, as well as for the integers a, |, m, n, u and v, likewise apply to elements of formula (CAT-II) correspondingly, where in formula (IS-IV) the core structure is defined by CIXmCr. The definition of boundary elements N, and N, is identical to the definitions provided above for Nu and N,.
[00531] [00531] In particular in the context of the formulas (IS-I)-(IS-IV) above, a "nucleotide" is understood as a molecule comprising or preferably consisting of a nitrogenous base (preferably selected from adenine (A) , cytosine (C), guanine (G), thymine (T), or uracil (U), a pentose sugar (ribose or deoxyribose), and at least one phosphate group. "Nucleosides" consist of a nucleobase and a pentose sugar (i.e. could be referred to as "nucleotides without phosphate groups"). Thus, a "nucleotide" comprising a specific base (A, C, G, T or U) preferably also comprises the respective nucleoside ( adenosine, cytidine, guanosine, thymidine or uridine, respectively) plus one (two, three or more) phosphate groups.
[00532] [00532] That is, the term "nucleotides" includes nucleoside monophosphates (AMP, CMP, GMP, TMP and UMP), nucleoside diphosphates (ADP, CDP, GDP, TDP and UDP), nucleoside triphosphates (ATP, CTP, GTP, TTP and UTP). In the context of formulas (IS-I)-(IS-IV) above, issue 870190141603, of 12/30/2019, p. 22303/22358 nucleoside phosphates are particularly preferred. The term "a nucleotide comprising (...) or an analogue thereof" refers to modified nucleotides comprising a modified (phosphate) backbone, pentose sugar(s), or nucleobases. In this context, nucleobase modifications are particularly preferred. By way of example, when referring to "a nucleotide comprising guanine, uracil, adenine, thymine, cytosine or an analogue thereof", the term "analogue thereof" refers to both the nucleotide and the nucleobases. cited, preferably to the cited nucleobases.
[00533] [00533] In preferred embodiments, the (pharmaceutical) composition or vaccine of the invention comprises at least one immunostimulatory RNA comprising or consisting of a nucleic acid sequence according to formula (IS-1) (GXmGrn), formula (IS-IIl) (CX-mCrn), formula (IS-IIl) (N.GXmGnNy)a, and/or formula (IS-IV) (NuCiXmC-nNy)a). In particularly preferred embodiments, the (pharmaceutical) composition or vaccine of the invention comprises at least one immunostimulatory RNA comprising or consisting of a nucleic acid sequence according to any one of SEQ ID NOs: 2938 - 3032.
[00534] [00534] In particularly preferred embodiments, the (pharmaceutical) composition or vaccine of the invention comprises a polymeric carrier cargo complex, formed by a polymeric carrier, preferably comprising disulfide-crosslinked cationic peptides, preferably Cys-Arg12, and/or or Cys-Arg12-Cys, and at least one ISRNA, preferably comprising or consisting of a nucleic acid sequence according to any one of SEQ ID NOs: 2938 - 3032.
[00535] [00535] The (pharmaceutical) composition or vaccine of the invention may additionally contain one or more auxiliary substances for authentication 870190141603, of 12/30/2019, p. 22304/22358 enhance its immunogenicity or immunostimulatory capacity, if desired. A synergistic action of the cargo polymeric carrier complex of the invention, as defined herein, and of an auxiliary substance, which may optionally be contained in the (pharmaceutical) composition or vaccine of the invention, as defined herein, is al- preferred in this way. Depending on the various types of auxiliary substances, various mechanisms can be taken into account in this regard. For example, compounds that allow the maturation of dendritic cells (DCs), eg lipopolysaccharides, TNF-alpha ligand or CD40, form a first class of suitable auxiliary substances. In general, it is possible to use as an auxiliary substance any agent that influences the immune system in the form of a "danger signal" (LPS, GP96 etc.) or cytokines, such as GM-CFS, which allow an immune response to be enhanced and /or influenced in a targeted manner. Particularly preferred auxiliary substances are cytokines, such as monokines, lymphokines, interleukins, or chemokines, which further promote the innate immune response, such as IL-1, IL-2, IL-3, IL-4, IL-5 , IL-6, IL-7, IL-8, IL-9, IL-10, IL-12, 11-13, IL-14, IL-15, IL-16, IL-17, 11-18, 11 -19, 11-20, 11-21, 11-22, I1L-23, I1L-24, 11-25, 11-26, 11-27, 11-28, 11-29, 11-30, 11-31 , 11-32, 11-33, INF-alpha, IFN-beta, INF-gamma, GM-CSF, G-CSF, M-CSF, LT-beta or TNF-alpha, growth factors such as hGH.
[00536] [00536] The (pharmaceutical) composition or vaccine of the invention may additionally contain any additional compound, which is known to be immunostimulatory due to its binding affinity (as ligands) to human Toll-like receptors TLR1, TLR2, TLR3, TLRA , TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, or because of their binding affinity (as ligands) to murine Toll-like receptors TLR1, TLR2, TLR3, TLRA4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR1IO , TLRI11, TLR12 or TLR13.
[00537] [00537] The (pharmaceutical) composition or vaccine of the invention may additionally contain CpG nucleic acids, in particular CDPOG-RNA or CpG-DNA. A CpG-RNA or CpG-DNA can be a single-stranded CpG-DNA (ss CpG-DNA), a double-stranded CpG-DNA (dsDNA), a single-stranded CpG-RNA (ss CPG-RNA), or a Double-stranded CpG-RNA (ds CpG-RNA). The CpG nucleic acid is preferably in the form of CpG-RNA, more preferably in the form of single-stranded CpG-RNA (ss CpPG-RNA). The CpG nucleic acid preferably contains at least one or more cytosine/guanine (mitogenic) dinucleotide sequence(s) (CpG motif(s)). According to a first preferred alternative, at least one CpG motif contained in those sequences, that is to say C (cytosine) and G (guanine) of the CpG motif, is unmethylated. All other cytosines or guanines optionally contained in these sequences may be methylated or unmethylated. According to another preferred alternative, however, the C (cytosine) and the G (guanine) of the CpG motif may also be present in the methylated form. kit
[00538] [00538] In another aspect, the present invention relates to a kit or kit of parts comprising the artificial nucleic acid molecule, preferably RNA, and/or the (pharmaceutical) composition or vaccine of the invention, and optionally a liquid carrier and /or optionally technical instructions with information on the administration and dosage of the artificial nucleic acid molecule or composition.
[00539] [00539] —Optionally, the kit of parts may comprise at least one additional agent, as defined herein in the context of pharmaceutical composition, antimicrobial agents, RNAse inhibitors, solubilizing agents, buffers, or the like. In preferred embodiments, the kit may contain, as a part, Ringer's Lactate solution.
[00540] [00540] The kit or kit of parts may be a kit of two or more parts and typically comprises each of the components described herein in suitable containers. For example, each container may be in the form of vials, bottles, squeeze bottles, pitchers, sealed sleeves, envelopes or pouches, tubes or blister packs, or any other suitable shape, provided the container is configured to avoid premature mixing of components. Each of the different components can be supplied separately or some of the different components can be supplied together (ie in the same container). A container may also be a compartment or chamber within a vial, tube, jar, envelope, sleeve or blister pack or bottle, provided the contents of a compartment are not capable of self-assembly. physically associate with the contents of the other compartment before deliberate mixing by a pharmacist or physician.
[00541] [00541] The kit may also contain technical instructions with information on the administration and dosage of any of its components. Medical Use and Treatment
[00542] [00542] In another aspect, the present invention provides the artificial nucleic acid molecule, preferably RNA, the (pharmaceutical) or vaccine composition, or the kit of the invention for human medical and also veterinary purposes, preferably for human medical purposes.
[00543] [00543] According to another aspect, the invention thus relates to the artificial nucleic acid molecule, preferably RNA, or (pharmaceutical) or vaccine composition, or kit of parts for use as a medicine.
[00544] [00544] The artificial nucleic acid molecule, preferably RNA, or the (pharmaceutical) composition or kit of parts are, among other things, provided for use in the treatment and/or prophylaxis of cancer, issue 870190141603, 30/30 12/2019, page 22307/22358 infectious diseases including viral, bacterial, fungal or protozoal infections, autoimmune diseases, graft versus host disease (GvHD) or allergies.
[00545] [00545] The term "treatment" of a disease includes preventing or protecting against the disease (ie, causing clinical symptoms not to develop); inhibiting the disease (ie, stopping or suppressing the development of clinical symptoms; and/or alleviating the disease (ie, causing the regression of clinical symptoms). As will be appreciated, it is not always possible to distinguish between "prevention" and "suppression" of a disease or disorder, as the ultimate inductive event or events may be unknown or latent. Therefore, the term "prophylaxis" will be understood as a type of "treatment" that encompasses both "prevention" as for “suppression.” The term “treatment” thus includes “prophylaxis”.
[00546] [00546] The term "subject", "patient" or "subject" as used herein generally includes humans and non-human animals and preferably mammals (e.g. non-human primates including marmosets, tamarins, macaques, spider, owl monkeys, vervet monkeys, squirrel monkeys, and baboons, monkeys, chimpanzees, orangutans, gorillas; cows; horses; sheep; pigs; chicken; cats; dogs; mice; rats; rabbits; guinea pigs ; etc.), including chimeric and transgenic animals and disease models. In the context of the present invention, the term "subject" preferably refers to a non-human primate or a human, more preferably, a human.
[00547] [00547] In accordance with preferred embodiments, treatment of cancer, infectious diseases including viral, bacterial, fungal or protozoal infections, autoimmune diseases, graft-versus-host disease (GvHD) or allergies is accomplished by administering to a subject in need for it, at least one 'ethition molecule 870190141603, of 12/30/2019, p. 22308/22358 artificial nucleic acid, preferably RNA, (pharmaceutical) composition or vaccine, or kit according to the invention. Preferably, administration is carried out parenterally, preferably intradermally, intramuscularly, intranodally, transdermally, subcutaneously or intratumorally. Preferably, the injection is performed by injection, eg using conventional needle injection or jet injection (no needle), preferably by jet injection (no needle). Prior to administration, treatment may include an optional step of preparing said artificial nucleic acid molecule, preferably RNA, or (pharmaceutical) composition or vaccine or kit.
[00548] [00548] The invention further relates to a method of treating cancer, infectious diseases including viral, bacterial, fungal or protozoal infections, autoimmune diseases, graft versus host disease (GvHD) or allergies comprising the steps of (a ) optionally preparing the artificial nucleic acid molecule, preferably RNA, or the (pharmaceutical) composition or vaccine or kit of the invention and (b) administering, to a subject in need thereof, at least one artificial nucleic acid molecule, preferably RNA, (pharmaceutical) composition or vaccine, or kit according to the invention.
[00549] [00549] The invention further relates to the use of the artificial nucleic acid molecule of the invention, preferably RNA, or the (pharmaceutical) composition or kit, preferably for the manufacture of a medicament to treat cancer, infectious diseases including infections by viruses, bacteria, fungi or protozoa, autoimmune diseases, graft versus host disease (GvHD) or allergies. Routes of Administration
[00550] [00550] The artificial nucleic acid molecule of the invention, preferably RNA, or the (pharmaceutical) composition or vaccine or kit 'edition 870190141603, of 12/30/2019, p. 22309/22358 can be administered, for example, systemically or locally.
[00551] [00551] Routes for systemic administration generally include, for example, transdermal, oral, parenteral routes, including subcutaneous, intravenous, intramuscular, intra-arterial, intradermal and intraperitoneal injections and/or intranasal routes of administration.
[00552] [00552] Routes for local administration in general include, for example, topical routes of administration, but also intradermal, transdermal, subcutaneous or intramuscular injections or intralesional, intratumoral, peritumoral injections, image-guided locoregional administration, intracranial, intrapulmonary, intracardiac, intranodular and sublingual.
[00553] [00553] It is still conceivable to use different routes of administration for different artificial nucleic acid molecules, preferably RNAs, of the invention and/or different parts of the kit.
[00554] [00554] According to preferred embodiments, the artificial nucleic acid molecule, preferably RNA, or the (pharmaceutical) composition or vaccine or kit is administered parenterally, preferably intradermally, intramuscularly, intranodally, transdermally, image-guided or intratumoral locoregional administration. Preferably, said artificial nucleic acid molecule, preferably RNA, or the (pharmaceutical) composition or vaccine or kit is administered by injection, for example subcutaneous, intramuscular, intradermal or intratumoral injection, which may be injection. without needle and/or with needle. Therefore, in preferred embodiments, the medical use and/or method of treatment according to the present invention involves the administration of said artificial nucleic acid molecule, preferably RNA, or the (pharmaceutical) composition or vaccine or kit by subcutaneous, intramuscular, intradermal or intratumoral injection. This injection can be performed using conventional needle injection or jet injection (without needle), preferably 'edition 870190141603, of 12/30/2019, p. 22310/22358 using jet injection (no needle). Administration Regime
[00555] [00555] The artificial nucleic acid molecule, preferably RNA, (pharmaceutical) composition or vaccine or kit of the invention (or components or parts thereof) can be administered to an individual in need thereof several times a day, once a day, every two days, weekly or monthly; and may be administered sequentially or simultaneously, optionally by different routes of administration, as defined above.
[00556] [00556] In accordance with some preferred embodiments, the artificial nucleic acid molecule, preferably RNA, (pharmaceutical) composition or vaccine or kit of the invention (or components or parts thereof) are administered simultaneously (i.e., at the same via the same or different routes of administration).
[00557] [00557] In accordance with other preferred embodiments, the artificial nucleic acid molecule, preferably RNA, (pharmaceutical) composition or vaccine or kit of the invention (or components or parts thereof) are administered separately (i.e., sequentially at different points). over time and/or through different routes of administration). This sequential administration schedule is also referred to as "time-staggered" administration. Dose
[00558] [00558] The artificial nucleic acid molecule, preferably RNA, (pharmaceutical) composition or vaccine or kit of the invention (or components or parts thereof) are preferably administered in a safe and therapeutically effective amount.
[00559] [00559] — As used herein, "safe and therapeutically effective amount" means an amount of the active agent(s) that is sufficient to elicit a desired biological or medicinal response in a tissue, system, animal or human being that 'edition 870190141603, of 12/30/2019, p. 22311/22358 is requesting. A "safe and therapeutically effective amount" is preferably sufficient to induce a positive modification of the disease to be treated, i.e. to alleviate the symptoms of the disease to be treated, to reduce the progression of the disease or to prophylaxis of the symptoms of the disease to be prevented. At the same time, however, a "safe and therapeutically effective amount" is small enough to avoid serious side effects, that is, to allow an adequate balance between benefit and risk.
[00560] [00560] A "safe and therapeutically effective amount" will also vary with respect to the specific condition being treated as well as the age, physical condition, body weight, sex and diet of the patient being treated, the severity of the condition, the duration of of treatment, the nature of the associated therapy, the pharmaceutically acceptable vehicle or excipient used, the treatment regimen, and similar factors. It can still vary depending on whether the artificial nucleic acid molecule employed, preferably RNA, is monocistronic, bicistronic or even multicistronic.
[00561] [00561] The therapeutic efficacy and toxicity of active agents can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, for example, to determine the LD50 (the lethal dose for 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and can be expressed as the LD50/ED50 ratio. Active agents that exhibit large therapeutic indices are generally preferred. Data obtained from cell culture assays and animal studies can be used in formulating a range of dosages for use in humans. The dosage of such compounds is preferably within a range of circulating concentrations that include the ED50 with little or no toxicity.
[00562] [00562] For example, therapeutically effective doses of the artificial nucleic acid molecule of the invention, preferably RNA, (pharmaceutical) composition or vaccine or kit described herein may range from about 0.001 mg to 10 mg, preferably from about from 0.01 mg to 5 mg, preferably about 0.1 mg to 2 mg per dosage unit or about 0.01 nmol to 1 mmol per dosage unit, in particular 1 nmol to 1 mmol per dosage unit. dosage unit, preferably 1 µmol to 1 mmol per dosage unit. It is also anticipated that the therapeutically effective dose of the artificial nucleic acid molecule of the invention, preferably RNA, (pharmaceutical) composition or drug or kit may vary (per kg of body weight) from about 0.01 mg. /kg to 10 g/kg, preferably from about 0.05 mg/kg to 5 g/kg, more preferably from about 0.1 mg/kg to 2.5 g/Kkg.
[00563] [00563] “Safe and therapeutically effective amounts of the artificial nucleic acid molecule of the invention, preferably RNA, (pharmaceutical) composition or vaccine or kit to be administered can be determined by routine experiments, for example using animal models. Such models include, without implying any limitation, rabbit, sheep, mouse, rat, dog, and non-human primate models. Cancer Diseases
[00564] [00564] In preferred embodiments, the artificial nucleic acid, preferably RNA, (pharmaceutical composition) or kit is used for cancer treatment or prophylaxis.
[00565] [00565] - In some embodiments, the artificial nucleic acid, preferably RNA, (pharmaceutical composition) or kit according to the invention can be used as a medicament, in particular for the treatment of tumor or cancer diseases. In this context, issue 870190141603, of 12/30/2019, p. 22313/22358 treatment preferably involves intratumoral application, mainly by intratumoral injection. Therefore, the artificial nucleic acid, preferably RNA, (pharmaceutical) composition or kit according to the invention can be used for the preparation of a medicament for the treatment of tumor or cancer diseases, said medicament being especially suitable for intratumoral application (administration) for the treatment of tumor or cancer diseases.
[00566] [00566] Preferably, tumor or cancer diseases, as mentioned herein, are selected from tumor or cancer diseases which may preferably include, for example, acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical carcinoma, AIDS-related cancers, AIDS-related lymphoma, anal cancer, appendix cancer, astrocytoma, basal cell carcinoma, bile duct cancer, bladder cancer, bone cancer, malignant fibrous osteosarcoma/histiocytoma, brain stem glioma, brain tumor, cerebellar astrocytoma, Cerebral astrocytoma/malignant glioma, ependymoma, medulloblastoma, supratentorial primitive neuroectodermal tumors, hypothalamic and visual pathway glioma, breast cancer, bronchial adenomas/carcinoids, Burkitt's lymphoma, childhood carcinoid tumor, gastrointestinal carcinoid tumor, primary carcinoma unknown , primary central nervous system lymphoma, infantile cerebellar astrocytoma, malignant gioma/astro childhood brain cytoma, cervical cancer, childhood cancers, chronic lymphocytic leukemia, chronic myeloid leukemia, chronic myeloproliferative disorders, colon cancer, cutaneous T-cell lymphoma, desmoplastic small round cell tumor, endometrial cancer, ependymoma, cervical cancer esophagus, Ewing's sarcoma in the Ewing's tumor family, extracranial germ cell tumor in childhood, extragonadal germ cell tumor, extrahepatic bile duct cancer, melanoma 'edition 870190141603, 12/30/ 2019, pg. 22314/22358 intraocular, Retinoblastoma, gallbladder cancer, gastric (stomach) cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor (GIST), extracranial, extragonadal or ovarian germ cell tumor, gestational trophoblastic tumor, brain stem glioma , infantile cerebral astrocytoma, infantile hypothalamic and visual pathway glioma, gastric carcinoid, hairy cell leukemia, head and neck cancer, heart cancer, hepatocellular (liver) cancer, Hodgkin's lymphoma, hypopharyngeal cancer, hypothalamic glioma childhood, intraocular melanoma, islet cell carcinoma (endocrine pancreas), Kaposi's sarcoma, renal cancer (renal cell cancer), laryngeal cancer, leukemias, acute lymphoblastic leukemia, acute myeloid leukemia, chronic lymphocytic leukemia , chronic myeloid leukemia, hairy cell leukemia, cancer of the lip and oral cavity, liposarcoma, liver cancer, lung cancer of non-small cell, small cell lung cancer, lymphomas, AIDS-related lymphoma, Burkitt's lymphoma, cutaneous T-cell lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphomas, primary central nervous system lymphoma, macroglobulinemia Waldenstrom, Malignant fibrous histiocytoma of bone/osteosarcoma, infantile medulloblastoma, Melanoma, Intraocular (eye) melanoma, Merkel cell carcinoma, adult malignant mesothelioma, infantile mesothelioma, metastatic squamous neck cancer with occult primary, cancer of mouth, childhood multiple endocrine neoplasia syndrome, multiple myeloma/plasma cell neoplasm, mycosis fungoides, myelodysplastic syndromes, myelodysplastic/myeloproliferative diseases, chronic myeloid leukemia, adult acute myeloid leukemia, childhood acute myeloid leukemia, multiple myeloma (bone marrow cancer), chronic myeloproliferative disorders, nasal cavity and paranasal sinus cancer, nasopharyngeal carcinoma ge, Neuroblastoma, oral cancer, oropharyngeal cancer, osteosarcoma/malignant fibrous histiocytoma of bones, 'edition 870190141603, dated 12/30/2019, p. 22315/22358 ovarian cancer, ovarian epithelial cancer (surface epithelial-stromal tumor), ovarian germ cell tumor, tumor with low ovarian malignant potential, pancreatic cancer, islet cell pancreatic cancer, nasal cavity and paranasal sinus cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pineal astrocytoma, pineal germinoma, supratentorial primitive neuroectodermal tumors and infantile pineoblastoma, pituitary adenoma, plasma cell neoplasm/multiple myeloma, pleuropulmonary blastoma, lymphoma of the system primary central nervous system, prostate cancer, rectal cancer, renal cell carcinoma (kidney cancer), cancer of the ureter and renal pelvis, retinoblastoma, childhood rhabdomyosarcoma, salivary gland cancer, sarcoma of the Ewing family of tumors, Kaposi, soft tissue sarcoma, uterine sarcoma, Sézary syndrome, skin cancer (non-melanoma), skin cancer (melanoma), carcinoma of the and Merkel cell skin, small bowel cancer, squamous cell carcinoma, metastatic squamous neck cancer with occult primary, infantile supratentorial primitive neuroectodermal tumor, testicular cancer, throat cancer, infantile thymoma, thymoma and thymic carcinoma, thyroid cancer, childhood thyroid cancer, transient cell cancer of the ureter and renal pelvis, gestational trophoblastic tumor, urethral cancer, uterine endometrial cancer, uterine sarcoma, vaginal cancer, hypothalamic and visual pathway glioma infantile, vulvar cancer, Waldenstrom's macroglobulinemia and infantile Wilms tumor (kidney cancer).
[00567] [00567] Examples of especially preferred tumors or cancers that are suitable for intratumoral administration are prostate cancer, lung cancer, breast cancer, brain cancer, head and neck cancer, thyroid cancer, colon cancer , stomach cancer, liver cancer, pancreatic cancer, ovarian cancer, skin cancer, bladder, uterus and cervix cancer.
[00568] [00568] The combination, pharmaceutical composition or kit of the invention can be used for the treatment of infectious diseases. The term "infection" or "infectious disease" refers to the invasion and multiplication of microorganisms, such as bacteria, viruses and parasites that are not normally present in the body. An infection may cause no symptoms and be subclinical, or it may cause symptoms and be clinically evident. An infection may remain localized or it may spread through the blood or lymphatic system to become systemic. Infectious diseases in this context preferably include viral, bacterial, fungal or protozoological infectious diseases. Combination Therapy
[00569] [00569] In accordance with some preferred embodiments, the medical uses and treatment methods of the invention may include subjecting the patient to combination therapy. Any therapy amenable to the treatment or prevention of diseases, disorders and conditions described herein (in particular, cancer, infectious diseases, autoimmune diseases, graft versus host diseases and allergies) may be combined with/employed in addition to the administration of the drug molecules. artificial nucleic acid of the invention, preferably RNAs, (pharmaceutical) composition or kit. Generally, the combination therapy can be performed before, simultaneously with or after the administration of said artificial nucleic acid molecule, (pharmaceutical) composition or vaccine, or kit of the invention and, among other factors, depends on the type and severity. of the disease, disorder or condition being treated. Cancer
[00570] [00570] The treatment of cancer may, in addition to the administration of the artificial nucleic acid molecule, (pharmaceutical) composition or vaccine, or kit of the invention, comprise one or more of the following items: 'edition 870190141603, of 12/30/ 2019, pg. 22317/22358 chemotherapy (e.g. first-line or second-line chemotherapy), radiation therapy, chemoradiation (combination of chemotherapy and radiation therapy), kinase inhibitors, antibody therapy and/or checkpoint modulators (e.g. , CTLAA inhibitors, inhibitors of the PD1 pathway) or inhibitors that induce the expression of T cell epitopes associated with defective peptide processing (TEIPPs), as disclosed in WO2012/089225. Accordingly, in some embodiments, the individual receiving the artificial nucleic acid molecule, (pharmaceutical) composition, or vaccine of the invention may be a cancer or tumor patient who has received or receives chemotherapy (e.g., first-line chemotherapy). or second line), radiotherapy, chemoradiation (combination of chemotherapy and radiotherapy), kinase inhibitors, antibody therapy and/or checkpoint modulators (e.g. CTLAA inhibitors, PD1 pathway inhibitors) or inhibitors which induce the expression of T cell epitopes associated with defective peptide processing (TEIPPs) disclosed in WO2012/089225, or a patient who has achieved partial response or stable disease after receiving one or more of the treatments specified above.
[00571] [00571] For example, the individual receiving the artificial nucleic acid molecule of the invention, preferably RNA, (pharmaceutical) composition or kit of parts, may be a cancer patient, preferably as defined herein, or a condition referred to as receiving chemotherapy (eg, first-line or second-line chemotherapy), radiation therapy, chemoradiation (combination of chemotherapy and radiation), tyrosine kinase inhibitors (eg, EGFR tyrosine kinase inhibitors), antibody therapy and/or inhibitory and/or stimulatory checkpoint molecules (eg, inhibitors of PD1, PD-L1, or CTLA4), or a patient who has achieved partial response or stable disease after receiving 'edition 870190141603, of 30 /12/2019, pg. 22318/22358 one or more of the treatments specified above. Or the subject receiving the artificial nucleic acid molecule of the invention, preferably RNA, (pharmaceutical) composition or kit of parts may be a patient with an infectious disease, preferably as defined herein, receiving antibiotic, antifungal or antiviral therapy. ral
[00572] [00572] In another aspect, the present invention also relates to the use of the artificial nucleic acid molecule of the invention, preferably RNA, (pharmaceutical) composition or kit of parts to support another cancer therapy, an infectious disease or any other disease treatable with said artificial nucleic acid molecule, (pharmaceutical) composition or Kit.
[00573] [00573] "Support" for cancer treatment or prophylaxis can be any combination of a conventional method of cancer therapy, such as surgery, radiation therapy, chemotherapy (e.g., first-line or second-line chemotherapy), chemoradiation , treatment with tyrosine kinase inhibitors, treatment with inhibitory and/or stimulatory checkpoint molecules, preferably inhibitors of PD1, PD-L1 or CTLAA, therapy with antibodies or any combination thereof, and therapy using the molecule of artificial nucleic acid of the invention, preferably RNA, composition (pharmaceutical) or kit of parts as defined herein. The administration of the artificial nucleic acid molecule of the invention, preferably RNA, (pharmaceutical) composition or kit of parts can be carried out before, simultaneously and/or after the administration of another therapeutic treatment or subjecting the patient to another treatment. therapy that is useful for the treatment of the specific disease or condition being treated. In Vitro Methods
[00574] [00574] In another aspect, the invention relates to a method of 'edition 870190141603, of 12/30/2019, p. 22319/22358 cell treatment or cell culture in vitro comprising (a) providing cells in vitro, (b) contacting said cells with the artificial nucleic acid molecule, preferably RNA, the (pharmaceutical) composition or vaccine, or the kit of the invention.
[00575] [00575] Without claiming to be bound by a specific theory, said cell treatment/culture method is considered to be particularly useful for the preparation of antigen presenting cells (APCs), such as dendritic cells (DCs), for subsequent expansion of T cells in vitro or in vivo. The cells are preferably contacted with said artificial nucleic acid molecule, preferably RNA, (pharmaceutical) composition or vaccine or kit in a suitable cell culture medium. Step (b) may, in particular, include a step of transfecting the cells with the artificial nucleic acid molecules, preferably RNAs, optionally composed of said (pharmaceutical) composition or vaccine, or kit. Transfection, that is, the act of deliberately introducing artificial nucleic acid molecules, preferably RNAs, into living cells, may, for example, involve microinjection or electroporation. After introduction into recipient cells, the artificial nucleic acid molecules, preferably RNAs, are preferentially translated, producing the antigenic fusion proteins of the invention, which are later presented through the MHC complex. DESCRIPTION OF THE FIGURES
[00576] [00576] Figure 1: General design of RNA constructs allowing targeting of epitopes or antigens to cellular compartments containing MHC class | and |l.
[00577] [00577] Figure 2: Induction of epitope-specific CD8+ T cells after vaccination with RNA encoding a murine Trp2 epitope with PADRE.
[00578] [00578] Figure 3: Induction of epitope-etition specific CD8+ T cells 870190141603, of 12/30/2019, pg. 22320/22358 po after vaccination with RNA encoding a murine Trp2 epitope with targeting sequence derived from IRSTepm-(CTLAA4).
[00579] [00579] Figure 4: Induction of epitope-specific CD8+ T cells after vaccination with RNA encoding an epitope of ovalbumin with targeting sequence derived from IRSTepm-(CTLAA4).
[00580] [00580] Figure 5: Vaccination with RNA encoding an IRSTepm-derived targeting sequence OVA epitope (CTLAA4) induces a significant antitumor response in E.G7-OVA tumor-bearing mice.
[00581] [00581] Figure 6: Anti-tumor response induced by RNA encoding an OVA epitope with targeting sequence derived from IRSTepm-(CTLAA4-) is superior compared to vaccination with the corresponding peptide plus adjuvant.
[00582] [00582] — C57BL/6 mice were injected intradermally (i.d.) at 4 sites with RNA constructs encoding a Trp2 epitope linked to a T cell helper epitope (PADRE) (641ug of RNA in 50ul of PBS). The Trp2 peptide SVYYDFFVWL is a confirmed CD8+ T cell epitope.
[00583] [00583] On days O, 3, 7, 10 and 14 of the experiment, mice were injected i.d. with mRNA diluted in Ringer's buffer with Lactate according to Table 8 below. The total volume for intradermal vaccination was 80ul and was distributed to 4 injection sites. 6 days after the last vaccination, an ICS was performed to assess epitope-specific CD8+ T cell responses. Therefore, CD8+ T cells were stimulated with the corresponding peptide and, as a control, with an irrelevant peptide. In neither group, epitope-specific CD8+ T cell responses were observed (Figure 2). 'edition 870190141603, of 12/30/2019, page 22321/22358
[00584] [00584] — C57BL/6 mice were injected intradermally (id) at 4 sites with RNA constructs encoding an ovalbumin or Trp2 epitope linked to a T cell helper epitope (PADRE) with the CTLA4 targeting approach (641ug RNA in 50pl of PBS). Ovalbumin peptides (LESIINFEKLTE) and Trp2 (SVYDFFVWL) are known CD8+ T cell epitopes.
[00585] [00585] On days O, 3, 7, 10 and 14 of the experiment, mice were injected i.d. with RNA diluted in Ringer's buffer with lactate according to Table 9 below. The total volume for intradermal vaccination was 80ul and was distributed to 4 injection sites. 6 days after the last vaccination, an ICS was performed to assess epitope-specific CD8+ T cell responses. Therefore, CD8+ T cells were stimulated with the corresponding peptide and, as a control, with an irrelevant peptide. In both groups, epitope-specific CD8+ T cell responses were observed (Figure 3 and 4). Table 9: Groups, treatment and RNA dilution Groups — Constructs (amount of RNA) No. of mice Os » A“ CTLA4-OVA-PADRE (64149) 6 2913 B CTLA4-Trp2-PADRE (6419) 6 2914 [ Buffer 6
[00586] [00586] More specifically, constructs according to A preferably have the following structure: HSCTLA4(1-35) Linker GgOva (249-273) Linker PADRE Linker HsSCTLA4(162-223).
[00587] [00587] —“C57BL/6 mice were injected subcutaneously (s.c.) with 3x10º E.G7-OVA cells per mouse (in a 100ul volume of PBS) in the right flank on day O of the experiment. On day 4 after tumor inoculation, C57BL/6 mice were injected i.d. at 4 sites with RNA constructs encoding an ovalbumin epitope (LESIINFEKLTE) and a T cell helper epitope (PADRE) with the CTLA4 targeting approach (641ug RNA in 80ul Lactate Ringer's buffer). Two additional groups were vaccinated i.d. with full-length MRNA-encoded ovalbumin protein (RNActive) (Figure 5) or ovalbumin peptide in combination with RNAdjuvant (Figure 6).
[00588] [00588] On days 00,3,7,10 and 14 of the experiment, mice were injected i.d. with RNA or peptide according to Table 10 and 11 below.
[00589] [00589] Tumor growth was monitored by measuring tumor size in three dimensions using forceps. Tumor volume was calculated according to the following formula: volume (mm ) length. (mm ) x SS width (mm ) Result:
[00590] [00590] — Vaccination with RNA encoding an OVA epitope with the CTLA4 targeting approach induces a significant antitumor response in E.G7-OVA tumor-bearing mice (Figures 5 and 6). Anti-tumor response induced by RNA encoding an OVA epitope with the targeted approach is superior compared to vaccination with the corresponding peptide plus an RNA-based adjuvant (RNAdjuvant) (Figure 6). 'edition 870190141603, of 12/30/2019, page 22323/22358
[00591] [00591] — C57BL/6 mice were injected intradermally (id) at 4 sites with mMRNA constructs encoding different ovalbumin epitopes linked to a T cell helper epitope (PADRE) with the CTLA4 targeting approach (32ug MRNA in 50 yu!l of PBS). Short ovalbumin peptide (LESIINFEKL-TE) and long ovalbumin epitope (EVSGLEQLESIINFEKLTEW-TSSNV) covering the known CD8+ T cell epitope of ovalbumin.
[00592] [00592] On days 0, 7 and 14 of the experiment, mice were injected i.d. with mRNA diluted in Ringer's buffer with Lactate according to Table 11 below. The total volume for intradermal vaccination was 80ul and was distributed to 4 injection sites. 6 days after the last vaccination, an ICS was performed to assess epitope-specific CD8+ T cell responses. Therefore, CD8+ T cells were stimulated with the corresponding peptide and, as a control, with medium. In both groups, specific CD8+ T cell responses 'edition 870190141603, dated 12/30/2019, p. 22324/22358 epitope were observed (Figure 7). Table 11: CTLA4-OVA-PADRE (long peptide) EF RNA groups, treatment and dilution — 6 77062 AND CTLA4-OVA-PADRE (short peptide) — 6 2913 E Buffer 3 - ITEMS
[00593] [00593] The present invention can be characterized by the following items:
1. An artificial nucleic acid molecule comprising at least one coding region encoding a. at least one antigenic peptide or protein, and at least one additional amino acid sequence derived from at least one immune response activation signal transduction protein located in the outer plasma membrane.
2. The artificial nucleic acid molecule according to item 1, wherein said immune response activation signal transduction protein located on the outer plasma membrane (IRS-Tepm) is selected from CTLAA4 (lymphocyte-associated protein 4). cytotoxic T), CD36 (platelet glycoprotein 4), TRBC2 (T cell receptor beta-chain 2 C region), TRDC (T cell receptor delta-chain C region), TLR4 (T cell receptor Toll type 4), CD4 (CD4 T cell surface glycoprotein), TRBC1 (T cell receptor beta-chain 1 C region), CD3E (CD3 T cell surface glycoprotein epsilon chain), PTPRC (receptor-like protein tyrosine phosphatase C), FCG3A (LNP-III-A low-affinity immunoglobulin Fc gamma region receptor), CD28 (CD28 T cell-specific surface glycoprotein), CD79A (alpha chain associated protein) ada to B-cell antigen receptor complex), CD19 (antigen 'etition 870190141603, dated 12/30/2019, p. 22325/22358 B lymphocyte CD19), NKG2D (integral membrane protein type I NKG2-D), FCERG (high-affinity immunoglobulin epsilon receptor gamma subunit), CD79B (beta chain associated protein of the B cell antigen receptor), CD86 (CD86 T lymphocyte activating antigen), CD226 (CD226 antigen), MUC17 (Mucin-17), CD209 (CD209 antigen), TLR8 (Toll-like receptor 8), or a variant, fragment or derivative of any of these proteins.
3. The artificial nucleic acid molecule according to item 1 or 2, wherein said at least one additional amino acid sequence comprises or consists of: b. at least one transmembrane domain and optionally c. at least one cytoplasmic domain.
4. The artificial nucleic acid molecule according to any one of the above, wherein said at least one coding region further encodes d. at least one signal peptide.
5. The artificial nucleic acid molecule according to any of the above, wherein said at least one antigenic peptide or protein is selected or derived from tumor antigens, viral, bacterial, protozoan, fungal or allogeneic antigens .
6. The artificial nucleic acid molecule according to item 5, wherein said at least one antigenic peptide or protein comprises or consists of an amino acid sequence corresponding to any one of SEQ ID NOs: 3719 - 27945; 76420 - 76439, 76440 - 76474, or a fragment, variant or derivative thereof, and is optionally encoded by a nucleic acid sequence according to any one of SEQ ID NOs: 27946 - Issue 870190141603, of 12/30/2019 , p. 22326/22358
52172; 76495 - 76514, 52173 - 76399; 76570 — 76589, 76515 — 76549, 76590 - 76624 or a fragment, variant or derivative of any of said sequences.
7. The artificial nucleic acid molecule according to item 5 or 6, wherein said tumor antigen is selected from BRAF, PIK3CA, KRAS, IDH1, TP53, NRAS, AKTI, SF3B1, CDKN2A, RPSAP58, EGFR, NY -ESO1, MUC-1, 5T4, Her2, MAGE-A3, LY6K, CEACAM6, CEA, MCAK, KK-LC1, Gastrin, VEGFR2, MMP-7, MPHOSPH1, MAGE-A4, MAGE-A1, MAGE-C1, PRAME , Survivin, MAGE-A9, MAGE-C2, FGFR2, WT1, PSA, PSMA, prostate-specific antigen precursor, Kitakyushu lung cancer antigen 1, trophoblast glycoprotein, 2A-dependent kinase inhibitor of cyclin, cyclin-dependent kinase inhibitor 2A, isoforms 1/2/3, cyclin-dependent kinase 4 inhibitor p16/multiple tumor suppressor 1, GTPase NRas or a fragment, variant or derivative of any of said antigens tumors, or any combination thereof.
8. The artificial nucleic acid molecule according to any one of the above, wherein said IRSTepm comprises or consists of an amino acid sequence corresponding to any one of SEQ ID NOs: 157-179, or a fragment, variant or derivative thereof, and is optionally encoded by a nucleic acid sequence corresponding to any one of SEQ ID NOs: 365-387, 573-595, 781-803, 989—1011, 1197-1219, 1405-1427 , 1613-1635, 1821-1843, 2029-2051, 2237-2259, 2445-2467, 2653-2675, 2861-2883, or a fragment, variant or derivative of any of said sequences.
9. The artificial nucleic acid molecule according to any one of items 3 to 8, wherein the at least one additional amino acid sequence comprises or consists of at least one issue 870190141603 of 12/30/2019, page 22327/22358 transmembrane domain and at least one cytoplasmic domain comprising or consisting of an amino acid sequence corresponding to any one of SEQ ID NOs: 76625 - 76647, or a fragment, variant or derivative thereof and is optionally encoded by a nucleic acid sequence corresponding to any one of SEQ ID NOs: 76648 - 76947, 77004-77017, 77066 or a fragment, variant or derivative of any of said sequences.
10. The artificial nucleic acid molecule according to any one of items 3 to 8, wherein the transmembrane domain comprises or consists of an amino acid sequence corresponding to any one of SEQ ID NOs: 180-208, or a fragment, variant or derivative thereof and is optionally encoded by a nucleic acid sequence corresponding to any one of SEQ ID NOs: 388 — 416, 596 — 624, 804 — 832, 1012 — 1040, 1220 — 1248, 1428 — 1456, 1636 — 1664, 1844 — 1872, 2052 — 2080, 2260 — 2288, 2468 — 2496, 2676 — 2704, 2884 — 2912, or a fragment, variant or derivative of any of said sequences.
11. The artificial nucleic acid molecule according to any one of items 4 to 10, wherein the signal peptide comprises or consists of an amino acid sequence corresponding to any one of SEQ ID NOs: 1 - 156, 76948 - 76951, or a fragment, variant or derivative thereof, and is optionally encoded by a nucleic acid sequence according to any one of SEQ ID NOs: 209 - 364, 76952 - 76955, 625 - 780, 76960 - 76963, 833 - 988, 76967 - 572, 76956 - 76959, 1249 - 1404, 76972 - 76975, 1457 - 7697, 1665 - 1820, 76980 - 76983, 1873 - 2028, 76984 - 76987, 2081 - 2236, 76988 - 76991, 2289 - 2444, 76992 - 76995, 2497 - 2652, 76996 - 76999, 2705 - 2860, 77000 - 77003, or 76968 - 76971 or a fragment, variant or derivative of 'etiction 870190141603 of 30 /12/2019, pg. 22328/22358 same.
12. The artificial nucleic acid molecule according to any one of the above, further encoding in its at least one coding region e.g. at least one binder.
13. The artificial nucleic acid molecule according to item 12, wherein said linker is a non-immunogenic linker, optionally comprising or consisting of an amino acid sequence according to any one of SEQ ID NOs: 2937, 76400-76418, 77018-77058 optionally encoded by a nucleic acid sequence according to any one of SEQ ID NOs: 2936, 76494, 76569, 76475-76493, 76550-76568, 77059-77061 or a fragment, variant or derivative of any of said sequences.
14. The artificial nucleic acid molecule according to any one of the above, wherein said at least one coding region still encodes f. at least one T helper epitope.
15. The artificial nucleic acid molecule according to item 14, wherein said helper epitope sequence comprises or consists of an amino acid sequence corresponding to any one of SEQ ID NOs: 3083 - 3294, or a fragment , variant or derivative thereof, and is optionally encoded by a nucleic acid sequence according to any one of SEQ ID NOs: 3295 - 3506, 3507 - 3718, or a fragment, variant or derivative of any of said sequences .
16. The artificial nucleic acid molecule according to any one of the above, comprising at least one coding region of the following Formula (II), preferably in the 53 direction: -(SIG)a-(L)5-[( AN)--(L)a]Je-[(IM)m-(L)nlo-(TMD/TMCD),p-(1) 'edition 870190141603, of 12/30/2019, p. 22329/22358 wherein "SIG" encodes a signal peptide, preferably as defined in item 11, "L" encodes a linker sequence, preferably as defined in item 13, each "AN" encodes an identical antigenic peptide or protein or different, preferably as defined in item 5, 6 or 7, "IM" encodes a helper epitope, preferably as defined in item 14 or 15, "TMD/TMCD" encodes an amino acid sequence derived from a signal transduction protein of immune response located in the outer plasma membrane, preferably a transmembrane domain, preferably as defined in item 10, and optionally a cytoplasmic domain, preferably as defined in item 9 b, d, m, n, o is, each independently, an integer selected from 0, 1, 2, 3,4,5,6,7,8,9 and 10, a, c, e, p is each independently a selected integer of 1, 2, 3.4, 5,6,7,8,9 and 10.
17. To the artificial nucleic acid molecule, according to any of the above, encoding in at least one coding region at least one, or a plurality of at least two, three, four, five, six, seven , eight, nine or ten antigenic peptides or proteins, optionally selected from at least one antigenic peptide or protein according to item 5 or 6, or fragment, variant or derivative thereof, or a combination of said peptides or proteins antigens, or their fragments, variants or derivatives.
18. The artificial nucleic acid molecule according to any one of items 1 to 17, wherein said nucleic acid molecule 870190141603, of 12/30/2019, p. 22330/22358 artificial cleico is an RNA.
19. The artificial nucleic acid molecule according to item 18, wherein the RNA is an mRNA, a viral RNA, a replicon RNA, or a circular RNA.
20. The artificial nucleic acid molecule, preferably RNA, according to any one of the above, wherein the artificial nucleic acid molecule is mono-, bi- or multicistronic.
21. To the artificial nucleic acid molecule, preferably RNA, according to any one of the above, wherein said artificial nucleic acid molecule is modified, preferably stabilized.
22. To the artificial nucleic acid molecule, preferably RNA, according to any of the above, wherein - the G/C content of the at least one coding region is high compared to the G/C content of the corresponding coding sequence of the corresponding wild-type artificial nucleic acid, and/or wherein - the C content of the at least one coding region is high compared to the C content of the corresponding coding sequence of the corresponding wild-type artificial nucleic acid, and/or wherein - the codons in the at least one coding region are adapted for human codon usage, wherein the codon adaptation index (CAI) is preferably high or maximized in the at least one coding sequence of the artificial nucleic acid, - wherein the amino acid sequence encoded by the artificial nucleic acid is preferably not being modified compared to the amino acid sequence encoded by the nucleic acid a corresponding wild-type artificial.
23. The artificial nucleic acid molecule, preferably edition 870190141603, of 12/30/2019, pg. 22331/22358 and RNA according to item 22, wherein said at least one coding region comprises or consists of a nucleic acid sequence corresponding to any one of SEQ ID NOs: 417-2912, 76671 - 76947, 77004 -77017, 77066.
24. To the artificial nucleic acid molecule, preferably RNA, according to any one of the above, which comprises a 5-CAP structure, preferably m7GpppN or Cap1.
25. The artificial nucleic acid molecule, preferably RNA, according to any one of the above, which comprises at least one histone stem-loop structure.
26. The artificial nucleic acid molecule, preferably RNA, according to item 25, wherein the at least one histone stem-loop structure comprises a nucleic acid sequence according to the following formulas (11 ) or (Ill): formula (Il) (stem-loop structure sequence without stem boundary elements): [No-2GN3-5] [No-4(U/T)No-4] [N3- 5CNo-2]
EGG OO OM stem1 loop stem2 formula (Ill) (stem-loop structure sequence with stem boundary elements): N1-6 [No-2GN3-5] [No-4(U/T)No-4] [N3 -5CNo-2] N1-6 VI O o stem 1 stem1 handle stem2 stem2 boundary element boundary element where: boundary elements of stem1 or stem2 N1.; are a consecutive sequence from 1 to 6, preferably from 2 to 6, more preferably 870190141603, of 12/30/2019, p. 22332/22358 preferably from 2 to 5, even more preferably from 3 to 5, more preferably from 4 to 5 or 5 N, wherein each N is, independently of the other, selected from a nucleotide selected from A, U, T , Ge C, or a nucleotide analogue thereof;
stem1 [No-2GN3-5] is reverse complementary or partially reverse complementary to the stem2 element, and is a consecutive sequence of between 5 to 7 nucleotides;
wherein No.o is a consecutive sequence from 0 to 2, preferably from 0 to 1, more preferably from 1 N, wherein each N is, independently of the other, selected from a nucleotide selected from A, U, T, G and C or a nucleotide analogue thereof;
wherein N3.5 is a consecutive sequence from 3 to 5, preferably from 4 to 5, more preferably from 4 N, wherein each N is, independently of the other, selected from a nucleotide selected from A, U, T, G and C or a nucleotide analogue thereof, and wherein G is guanosine or an analogue thereof, and may optionally be substituted by a cytidine or an analogue thereof, provided that its complementary nucleotide cytidine on the stem2 be replaced by guanosine;
loop sequence [No4(U/T)No4] is located between the stem1 and stem2 elements, and is a consecutive sequence of 3 to 5 nucleotides, more preferably of 4 nucleotides;
where each No. is, independently of the other, a consecutive sequence from 0 to 4, preferably from 1 to 3, more preferably from 1 to 2 N, where each N is, independently of the other, selected of a nucleotide selected from A, U, T, Ge C or a nucleotide analogue thereof; and wherein U/T represents uridine or, optionally, thymidine;
stem2 [N3-.5CNo.2] is reverse complementary or partially reverse complementary to the stem1 element, and is a sequence
'edition 870190141603, of 12/30/2019, page 22333/22358 consecutive from 5 to 7 nucleotides; wherein N3.5 is a consecutive sequence from 3 to 5, preferably from 4 to 5, more preferably from 4 N, wherein each N is, independently of the other, selected from a nucleotide selected from A, U, T, G and C or a nucleotide analogue thereof; wherein No.o is a consecutive sequence from 0 to 2, preferably from 0 to 1, more preferably from 1 N, wherein each N is, independently of the other, selected from a nucleotide selected from A, U, T, G and C or a nucleotide analogue thereof; and wherein C is cytidine or an analogue thereof, and may optionally be substituted by a guanosine or an analogue thereof provided that its stem 1 complementary nucleotide guanosine is substituted with cytidine; where stem1 and stem2 are capable of base pairing with each other forming a complementary reverse sequence, in which base pairing can occur between stem1 and stem2, or forming a complementary partially reversed sequence, in which an incomplete base pairing can occur between stem1 and stem2.
27. To the artificial nucleic acid molecule, preferably RNA, according to item 25 or 26, wherein the at least one histone stem-loop structure comprises a nucleic acid sequence according to the following formulas (lla) or (llla): formula (lla) (rod-loop structure sequence without [No-1GN3-5] [N1-3(U/T)No-2] [N3-5CNo-1] or To To stem1 handle stem2 'edition 870190141603, 12/30/2019, page 22334/22358 stem boundary elements): formula (llla) (stem-loop structure sequence with stem boundary elements): N2-5 [No. -1GN3-5] [N1-3(U/T)No-2] [N3-5CNo-1] N2-5 VI oo stem 1 stem1 handle stem2 stem2 boundary element boundary element
28. The artificial nucleic acid molecule, preferably RNA, according to any one of the above, optionally comprising a poly(A) sequence, preferably comprising 10 to 200, 10 to 100, 40 to 80 or 50 to 70 nucleotides of adenosine.
29. The artificial nucleic acid molecule, preferably RNA, according to any one of the above, optionally comprising a poly(C) sequence, preferably comprising 10 to 200, 10 to 100, 20 to 70, 20 to 60 or 10 to 40 nucleotides of cytosine.
30. The artificial nucleic acid molecule, preferably RNA, according to any one of the above, which comprises, preferably in the 5' to 3' direction, the following elements: a) a 5'-CAP structure, preferably m7GpppN, a Cap ARCA or Cap1 b) optionally a 5-UTR element, preferably comprising or consisting of a nucleic acid sequence, corresponding to the nucleic acid sequence according to SEQ ID NOs: 3061 or 3063 or a fragment, variant or corresponding RNA sequence thereof, Cc) at least one coding sequence as defined in any of the above, 'issue 870190141603, 12/30/2019, p. 22335/22358 d) optionally a 3'-UTR element, preferably comprising or consisting of a nucleic acid sequence corresponding to the nucleic acid sequence according to SEQ ID NOs: 3065; 3067; 3069; 3071; 3073; 3075 or 3077, or a corresponding RNA fragment, variant or sequence thereof, e) optionally a poly(A) tail, preferably consisting of 10 to 1000, 10 to 500, 10 to 300 10 to 200, 10 to 100 .40 to 80 or 50 to 70 nucleotides of adenosine, f) optionally a poly(C) tail, preferably consisting of 10 to 200, 10 to 100, 20 to 70, 20 to 60 or 10 to 40 nucleotides of cytosine, and g) optionally a histone stem-loop structure, optionally comprising or consisting of a nucleic acid sequence corresponding to SEQ ID NO: 3079 or 3080.
31. The composition comprising at least one artificial nucleic acid molecule, preferably RNA, according to any one of items 1 to 30 and a pharmaceutically acceptable carrier and/or excipient.
32. The composition according to item 31, comprising a plurality of at least two molecules of artificial nucleic acid according to any one of items 1 to 30, wherein preferably at least two of said plurality of artificial nucleic acid molecules encode a different antigenic peptide or protein, optionally selected from an antigenic peptide or protein as defined in item 5, 6 or 7, or a fragment, variant or derivative thereof.
33. The composition of item 31 or 32, wherein said composition is a pharmaceutical composition, optionally a vaccine.
34. The (pharmaceutical) composition or vaccine, according to 'edition 870190141603, of 12/30/2019, p. 22336/22358 item 33, in which the artificial nucleic acid molecule, preferably RNA, is complexed with one or more cationic or polycationic compounds, preferably with cationic or polycationic polymers, cationic or polycationic peptides or proteins, for example , protamine, cationic or polycationic polysaccharides and/or cationic or polycationic lipids.
35. The (pharmaceutical) composition or vaccine according to item 34, wherein the cationic or polycationic compound is a polymeric carrier.
36. The (pharmaceutical) composition or vaccine according to item 34, wherein the N/P ratio of the artificial nucleic acid molecule, preferably RNA, to the one or more cationic or polycationic compounds is in the range of about 0 .1 to 10, including a range from about 0.3 to 4, from about 0.5 to 2, from about 0.7 to 2, and from about 0.7 to 1.5.
37. The (pharmaceutical) composition or vaccine, according to any one of items 31 to 36, in which the artificial nucleic acid molecule, preferably RNA, is complexed with one or more lipids, thus forming lipid nanoparticles, lipoplexes and/or preferably liposomes.
38. The (pharmaceutical) composition or vaccine, according to any one of items 31 to 37, said composition further comprising a non-coding RNA selected from the group consisting of low interference RNA (siRNA), antisense RNA (asRNA ), circular RNA (circRNA), ribozymes, aptamers, riboswitches, immunostimulating RNA (iSsRNA), transfer RNA (tRNA), ribosomal RNA (rTRNA), small nuclear RNA (snRNA), small nucleolar RNA (SNoRNA) , microRNA (miRNA), and Piwi-interacting RNA (piRNA).
39. The (pharmaceutical) composition or vaccine, according to item 38, in which the immunostimulant RNA comprises at least 'edition 870190141603, of 12/30/2019, p. 22337/22358 an RNA sequence according to formula (IS-1) (GXmG»n), formula (IS-II) (CIXmCrn), formula (IS-III) (Nu.GXmGnNy) and/or formula (IS-IV) (Nu.CIXmCrNy)a).
40. The (pharmaceutical) composition or vaccine according to item 39, wherein the immunostimulatory RNA comprises at least one RNA sequence corresponding to any one of SEQ ID NOs: 2938 - 3032.
41. The (pharmaceutical) or vaccine composition of any one of items 31 to 40, wherein the composition comprises a polymeric carrier cargo complex formed from a polymeric carrier, preferably comprising disulfide-crosslinked cationic peptides, preferably Cys-Arg12, and/or Cys-Argi2-Cys, and an isRNA, preferably comprising or consisting of an RNA sequence corresponding to SEQ ID NOs: 2938 - 3032.
42. Kit, preferably kit of parts, comprising the artificial nucleic acid molecule, preferably RNA, according to any one of items 1 to 30, or the (pharmaceutical) composition or vaccine, according to any one of items 31 at 41, and optionally a liquid carrier and/or optionally technical instructions with information on administration and dosage of the artificial nucleic acid molecule or composition.
43. The kit according to item 42, wherein the kit contains, as a part, Lactate Ringer's solution.
44. The artificial nucleic acid molecule, preferably RNA, according to any one of items 1 to 30, the (pharmaceutical) composition or vaccine, according to any one of items 31 to 41, or the kit, according to with item 42 to 43, for use as a medicine.
45. The artificial nucleic acid molecule, preferably RNA, according to any one of items 1 to 30, composition 'edition 870190141603, of 12/30/2019, p. 22338/22358
(pharmaceutical) or vaccine, according to any one of items 31 to 41, or the kit, according to item 42 to 44, for use in a method of treatment or prophylaxis of cancer, infectious diseases including viral infections , bacteria, fungi or protozoa, autoimmune diseases, graft versus host disease (GvHD) or allergies.
46. The artificial nucleic acid molecule, preferably RNA, for the use according to item 45, wherein said use comprises (a) administering, to a subject in need thereof, said acid molecule artificial nucleic, preferably RNA, said (pharmaceutical) composition or vaccine or said kit.
47. The artificial nucleic acid molecule, preferably RNA, for use in accordance with item 46, wherein administration is parenterally, preferably intradermally, subcutaneously, intravenously, intramuscularly, intranodally, transdermally or intratumoral.
48. A method of treating or preventing cancer, autoimmune diseases or infectious diseases including viral, bacterial, fungal or protozoal infections, wherein the method comprises administering to a patient in need thereof an amount of the artificial nucleic acid molecule, preferably RNA, according to any one of items 1 to 30, the (pharmaceutical) composition or vaccine according to any one of items 31 to 41, or the kit according to item 42 to 43.
49. The use, in accordance with any one of items 44 to 47, or the method, in accordance with item 48, further comprising subjecting the patient to at least one or more of the following additional therapies: chemotherapy (for e.g. first-line or second-line chemotherapy), radiation therapy, chemoradiation (combination of chemotherapy and radiation), kinase inhibitors, antibody therapy, and/or checkpoint modulators (e.g. 'etition 870190141603 inhibitors' , dated 12/30/2019, page 22339/22358 of CTLAA, inhibitors of the PD1 pathway) or inhibitors that induce the expression of T cell epitopes associated with defective peptide processing (TEIPPs).
50. The use according to item 49, wherein said additional therapy is performed before, simultaneously with or subsequent to the administration of said artificial nucleic acid molecule, (pharmaceutical) composition or vaccine, or kit.
51. A method of cell treatment or cell culture in vitro comprising (a) providing cells in vitro, (b) contacting said cells with the artificial nucleic acid molecule, preferably RNA, according to any one of the following items. 1 to 30, the (pharmaceutical) composition or vaccine, according to any one of items 31 to 41, or the kit, according to item 42 to 43.
'edition 870190141603, of 12/30/2019, page 22340/22358

权利要求:
Claims (50)
[1]
1. Artificial nucleic acid molecule comprising at least one coding region encoding a. at least one antigenic peptide or protein, and at least one additional amino acid sequence derived from at least one immune response activation signal transduction protein located in the outer plasma membrane, characterized in that said at least one sequence of additional amino acid comprises or consists of at least one transmembrane domain.
[2]
2. Artificial nucleic acid molecule according to claim 1, characterized in that said immune response activation signal transduction protein located in the outer plasma membrane (IRSTepm) Is selected from CTLAA (protein 4 associated with cytotoxic T lymphocyte), CD36 (platelet glycoprotein 4), TRBC2 (T-cell receptor beta-chain 2-chain region), TRDC (T-cell receptor-delta-chain C region), TLRA4 (Toll-like receptor 4), CDA4 (CDA4 T cell surface glycoprotein), TRBC1 (T cell receptor beta-chain 1 C region), CD3E (CD3 T cell surface glycoprotein epsilon chain) , PTPRC (receptor-type protein tyrosine phosphatase C), FCG3A (LNP-III-A receptor of low-affinity immunoglobulin Fc gamma region), CD28 (CD28 T cell-specific surface glycoprotein), CD79A ( B cell antigen receptor complex-associated alpha protein chain), CD19 (lymph antigen CD19 B ocyte), NKG2D (NKG2-D type II integral membrane protein), FCERG (high-affinity immunoglobulin receptor gamma subunit), CD79B (B-cell antigen receptor complex-associated protein beta chain) ), CD86 (CD86 T lymphocyte activation antigen), CD226 (CD226 antigen), MUC17 (Mucin-17), CD209 (antigen 'edition 870190141603, dated 12/30/2019, p. 22341/22358
CD209), TLR8 (Toll-like receptor 8), or a variant, fragment or derivative of any of these proteins.
[3]
3. An artificial nucleic acid molecule according to claim 1 or 2, characterized in that said at least one additional amino acid sequence further comprises b. at least one cytoplasmic domain.
[4]
4. Artificial nucleic acid molecule, according to any one of the above claims, characterized in that said at least one coding region still encodes c. at least one signal peptide.
[5]
5. Artificial nucleic acid molecule, according to any one of the above claims, characterized in that said at least one antigenic peptide or protein is selected or derived from tumor antigens, viral, bacterial, protozoan, fungal antigens or allogeneic.
[6]
6. Artificial nucleic acid molecule according to claim 5, characterized in that said at least one antigenic peptide or protein comprises or consists of an amino acid sequence corresponding to any one of SEQ ID NOs: 3719 - 27945; 76420 - 76439, 76440 - 76474, or a fragment, variant or derivative thereof, and is optionally encoded by a nucleic acid sequence according to any one of SEQ ID NOs: 27946 - 52172; 76495 - 76514, 52173 - 76399; 76570 — 76589, 76515 — 76549, 76590 - 76624 or a fragment, variant or derivative of any of said sequences.
[7]
7. Artificial nucleic acid molecule according to claim 5 or 6, characterized in that said tumor antigen is selected from BRAF, PIK3CA, KRAS, IDH1, TP53, NRAS, AKTI, SF3B1, CDKN2A, RPSAP58 , EGFR, NY-ESO1, MUC-1, 574, Her2, MAGE-A3, LY6K, CEACAM6, CEA, MCAK, KK-LC1, Gastrin, 'edition 870190141603, of 12/30/2019, p. 22342/22358
VEGFR2, MMP-7, MPHOSPH1, MAGE-A4, MAGE-A1, MAGE-C1, PRAME, Survivin, MAGE-A9, MAGE-C2, FGFR2, WT1, PSA, PSMA, Prostate Specific Antigen Precursor, Prostate Antigen 1 Kita-kyushu lung cancer, trophoblast glycoprotein, cyclin-dependent kinase inhibitor 2A, cyclin-dependent kinase inhibitor 2A, isoforms 1/2/3, cyclin-dependent kinase 4 inhibitor p16/multiple tumor suppressor 1, GTPase NRas or a fragment, variant or derivative of any of said tumor antigens, or any combination thereof.
[8]
8. Artificial nucleic acid molecule, according to any one of the above claims, characterized in that said IRSTepm comprises or consists of an amino acid sequence corresponding to any one of SEQ ID NOs: 157-179, or a fragment, variant or derivative thereof, and is optionally encoded by a nucleic acid sequence corresponding to any one of SEQ ID NOs: 365-387, 573-595, 781--803, 989-1011, 1197- 1219, 1405-1427, 1613-1635, 1821-1843, 2029-2051, 2237-2259, 2445-2467, 2653-2675, 2861-2883, or a fragment, variant or derivative of any of said sequences.
[9]
9. Artificial nucleic acid molecule according to any one of claims 1 to 8, characterized in that the at least one additional amino acid sequence comprises or consists of at least one transmembrane domain and at least one cytoplasmic domain comprising or consisting of an amino acid sequence corresponding to any one of SEQ ID NOs: 76625 - 76647, or a fragment, variant or derivative thereof, and is optionally encoded by a nucleic acid sequence corresponding to any one of SEQ ID NOs: 76648 - 76947, 77004-77017, 77066 or a fragment, variant or derivative of any of said sequences.
'edition 870190141603, of 12/30/2019, page 22343/22358
[10]
10. Artificial nucleic acid molecule, according to any one of claims 1 to 8, characterized in that the transmembrane domain comprises or consists of an amino acid sequence corresponding to any one of SEQ ID NOs: 180-208, or a fragment, variant or derivative thereof and is optionally encoded by a nucleic acid sequence corresponding to any of SEQ ID NOs: 388 — 416, 596 — 624, 804 — 832, 1012 — 1040, 1220 — 1248, 1428 — 1456, 1636 — 1664, 1844 — 1872, 2052 — 2080, 2260 — 2288, 2468 — 2496, 2676 — 2704, 2884 — 2912, or a fragment, variant or derivative of any such sequence.
[11]
11. Artificial nucleic acid molecule according to any one of claims 4 to 10, characterized in that the signal peptide comprises or consists of an amino acid sequence corresponding to any one of SEQ ID NOs: 1 - 156, 76948 - 76951, or a fragment, variant or derivative thereof, and is optionally encoded by a nucleic acid sequence according to any one of SEQ ID NOs: 209 - 364, 76952 - 76955, 625 - 780, 76960 - 76963, 833 - 988, 76967 - 572, 76956 - 76959, 1249 - 1404, 76972 - 76975, 1457 - 7697, 1665 - 1820, 76980 - 76983, 1873 - 2028, 76984 - 76987, 2081 - 2236, 76988 - 76991, 2289 - 2444, 76992 - 76995, 2497 - 2652, 76996 - 76999, 2705 - 2860, 77000 - 77003, 1041 - 1196, or 76968 - 76971 or a fragment, variant or derivative thereof.
[12]
12. Artificial nucleic acid molecule, according to any one of the above claims, characterized in that it still encodes in its at least one d coding region. at least one binder.
[13]
13. Artificial nucleic acid molecule, according to claim 12, characterized in that said ligand is a 'edition 870190141603, of 12/30/2019, p. 22344/22358 non-immunogenic linker, optionally comprising or consisting of an amino acid sequence according to any one of SEQ ID NOs: 2937, 76400-76418, 77018-77058 optionally encoded by a nucleic acid sequence according to which either one of SEQ ID NOs: 2936, 76494, 76569, 76475-76493, 76550-76568, 77059-77061 or a fragment, variant or derivative of any of said sequences.
[14]
14. An artificial nucleic acid molecule according to any one of the above claims, characterized in that said at least one coding region further encodes e.g. at least one T helper epitope.
[15]
15. Artificial nucleic acid molecule according to claim 14, characterized in that said helper epitope sequence comprises or consists of an amino acid sequence corresponding to any one of SEQ ID NOs: 3083 - 3294, or a fragment , variant or derivative thereof, and is optionally encoded by a nucleic acid sequence according to any one of SEQ ID NOs: 3295 - 3506, 3507 - 3718, or a fragment, variant or derivative of any of the foregoing if - sequences.
[16]
An artificial nucleic acid molecule according to any one of the above claims, comprising at least one coding region of the following Formula (1), preferably in the 53' direction: -(SIG)a-(L)5-[( AN)--(L)a]e-[(IM)m-(L)nlo-(TMD/TMCD),- (1) characterized in that "SIG" encodes a signal peptide, preferably as defined in the claim 11, "L" encodes a linker sequence, preferably as defined in claim 13, 'Edition 870190141603, 12/30/2019, pg. 22345/22358 each "AN" encodes an identical or different antigenic peptide or protein, preferably as defined in claim 5, 6 or 7, "IM" encodes a helper epitope, preferably as defined in claim 14 or 15, "TMD/TMCD" encodes an amino acid sequence derived from an immune response signal transduction protein located in the outer plasma membrane, preferably a transmembrane domain, preferably as defined in claim 10, and optionally a cytoplasmic domain, preferably as defined in claim 9 b, d, m, n, o is each independently an integer selected from 0, 1, 2, 3,4,5,6,7,8,9 and 10, a, c, and p is each independently an integer selected from 1, 2, 3.4, 5,6,7,8,9, and 10.
[17]
17. Artificial nucleic acid molecule according to any one of the above claims, characterized in that it encodes in its at least one coding region at least one, or a plurality of at least two, three, four, five, six , seven, eight, nine or ten antigenic peptides or proteins, optionally selected from at least one antigenic peptide or protein, according to claim 5 or 6, or a fragment, variant or derivative thereof, or a combination thereof said antigenic peptides or proteins, or fragments, variants or derivatives thereof.
[18]
18. Artificial nucleic acid molecule, according to any one of claims 1 to 17, characterized in that said artificial nucleic acid molecule is an RNA.
[19]
19. Artificial nucleic acid molecule, according to claim 18, characterized in that the RNA is an mMRNA, a viral RNA, a replicon RNA or a circular RNA.
'edition 870190141603, of 12/30/2019, page 22346/22358
[20]
20. Artificial nucleic acid molecule, preferably RNA, according to any one of the above claims, characterized in that the artificial nucleic acid molecule is mono-, bi- or multicistronic.
[21]
21. Artificial nucleic acid molecule, preferably RNA, according to any one of the above claims, characterized in that said artificial nucleic acid molecule is modified, preferably stabilized.
[22]
22. Artificial nucleic acid molecule, preferably RNA, according to any one of the above claims, characterized by the fact that - the G/C content of at least one coding region is high compared to the G content /C of the corresponding coding sequence of the corresponding wild-type artificial nucleic acid, and/or wherein - the C content of the at least one coding region is high compared to the C content of the coding sequence corresponding wild-type artificial nucleic acid, and/or wherein - the codons in the at least one coding region are adapted for human codon usage, wherein the codon adaptation index (CAI) is preferably high or maximized in the at least one coding sequence of the artificial nucleic acid, - wherein the amino acid sequence encoded by the artificial nucleic acid is preferably not being modified compared to the amino acid sequence encoded by the corresponding wild-type artificial nucleic acid.
[23]
23. Artificial nucleic acid molecule, preferably RNA, according to claim 22, characterized in that said at least one coding region comprises or 'edition 870190141603, of 12/30/2019, p. 22347/22358 consists of a nucleic acid sequence corresponding to any one of SEQ ID NOs: 417-2912, 76671 - 76947, 77004-77017,
77066.
[24]
24. Artificial nucleic acid molecule, preferably RNA, according to any one of the above claims, characterized in that it comprises a 5'-CAP structure, preferably m7GpppN or Cap1.
[25]
25. Artificial nucleic acid molecule, preferably RNA, according to any one of the above claims, characterized in that it comprises at least one histone stem-loop structure.
[26]
26. Artificial nucleic acid molecule, preferably RNA, according to claim 25, characterized in that the at least one histone stem-loop structure comprises a nucleic acid sequence according to the following formulas (11 ) or (Ill): formula (Il) (stem-loop structure sequence without stem boundary elements): [No-2GN3-5] [No-4(U/T)No-4] [N3- 5CNo-2]
The stem1 loop stem2 formula (Ill) (stem-loop structure sequence with stem boundary elements): N1-6 [No-2GN3-5] [No-4(U/T)No-4] [N3-5CNo -2] N1-6 O so 7 stem 1 stem1 handle stem2 stem2 boundary element boundary element where 'edition 870190141603, dated 12/30/2019, p. 22348/22358 boundary elements of stem1 or stem2 N1.s are a consecutive sequence from 1 to 6, preferably from 2 to 6, more preferably from 2 to 5, even more preferably from 3 to 5, most preferably from 4 a 5 or 5 N, wherein each N is, independently of the other, selected from a nucleotide selected from A, U, T, Ge C, or a nucleotide analog thereof;
stem1 [No-2GN3-5] is reverse complementary or partially reverse complementary to the stem2 element, and is a consecutive sequence of between 5 to 7 nucleotides;
wherein No.o is a consecutive sequence from 0 to 2, preferably from 0 to 1, more preferably from 1 N, wherein each N is, independently of the other, selected from a nucleotide selected from A, U, T, G and C or a nucleotide analogue thereof;
wherein N3.5 is a consecutive sequence from 3 to 5, preferably from 4 to 5, more preferably from 4 N, wherein each N is, independently of the other, selected from a nucleotide selected from A, U, T, G and C or a nucleotide analogue thereof, and wherein G is guanosine or an analogue thereof, and may optionally be substituted by a cytidine or an analogue thereof, provided that its complementary nucleotide cytidine on the stem2 be replaced by guanosine;
the loop sequence [No-4(U/T)No-4] is located between the stem1 and stem2 elements, and is a consecutive sequence of 3 to 5 nucleotides, more preferably of 4 nucleotides;
where each No. is, independently of the other, a consecutive sequence from 0 to 4, preferably from 1 to 3, more preferably from 1 to 2 N, where each N is, independently of the other, selected of a nucleotide selected from A, U, TT Ge C or a nucleotide analogue thereof; and wherein U/T represents uridine or, optionally, thymidine;
'edition 870190141603, of 12/30/2019, page 22349/22358 stem2 [N3-.5CNo.2] is reverse complementary or partially reverse complementary to the stem1 element, and is a consecutive sequence of between 5 to 7 nucleotides; wherein N3.5 is a consecutive sequence from 3 to 5, preferably from 4 to 5, more preferably from 4 N, wherein each N is, independently of the other, selected from a nucleotide selected from A, U, T, G and C or a nucleotide analogue thereof; wherein No.o is a consecutive sequence from 0 to 2, preferably from 0 to 1, more preferably from 1 N, wherein each N is, independently of the other, selected from a nucleotide selected from A, U, T, G and C or a nucleotide analogue thereof; and wherein C is cytidine or an analogue thereof, and may optionally be substituted by a guanosine or an analogue thereof provided that its stem-1 complementary nucleotide guanosine is substituted with cytidine; where stem1 and stem2 are capable of base pairing with each other forming a complementary reverse sequence, in which base pairing can occur between stem1 and stem2, or forming a complementary partially reversed sequence, in which an incomplete base pairing can occur between stem1 and stem2.
[27]
27. Artificial nucleic acid molecule, preferably RNA, according to claim 25 or 26, characterized in that the at least one histone stem-loop structure comprises a nucleic acid sequence according to the following formulas (lla) or (llla): 'edition 870190141603, of 12/30/2019, p. 22350/22358 formula (lla) (rod-loop structure sequence without [No-1GN3-5] [N1-3(U/T)No-2] [N3-5CNo-1] o stem1 loop stem2 boundary elements of stem): formula (llla) (stem-loop structure sequence with stem boundary elements): N2-5 [No-1GN3-5] [N1-3(U/T)No-2] [N3-5CNo- 1] N2-5 VI o DO stem 1 stem1 handle stem2 stem2 boundary element boundary element
[28]
28. An artificial nucleic acid molecule, preferably RNA, according to any one of the above claims, characterized in that it optionally comprises a poly(A) sequence, preferably comprising 10 to 200, 10 to 100, 40 to 80 or 50 to 70 nucleotides of adenosine.
[29]
29. An artificial nucleic acid molecule, preferably RNA, according to any one of the above claims, characterized in that it optionally comprises a poly(C) sequence, preferably comprising 10 to 200, 10 to 100, 20 to 70, 20 to 60 or 10 to 40 nucleotides of cytosine.
[30]
30. Artificial nucleic acid molecule, preferably RNA, according to any one of the claims above, characterized in that it comprises, preferably in the 5' to 3' direction, the following elements: a) a 5-CAP structure, preferably m7GpppN, a Cap ARCA or Cap1 'edition 870190141603, of 12/30/2019, p. 22351/22358 b) optionally a 5-UTR element, preferably comprising or consisting of a nucleic acid sequence, corresponding to the nucleic acid sequence according to SEQ ID NOs: 3061 or 3063 or a corresponding RNA fragment, variant or sequence thereof, c) at least one coding sequence as defined in any one of the above claims, d) optionally a 3'-UTR element, preferably comprising or consisting of a nucleic acid sequence corresponding to the nucleic acid sequence according to with SEQ ID NOs: 3065; 3067; 3069; 3071; 3073; 3075 or 3077, or a corresponding RNA fragment, variant or sequence thereof, e) optionally a poly(A) tail, preferably consisting of 10 to 1000, 10 to 500, 10 to 300 10 to 200, 10 to 100 .40 to 80 or 50 to 70 nucleotides of adenosine, f) optionally a poly(C) tail, preferably consisting of 10 to 200, 10 to 100, 20 to 70, 20 to 60 or 10 to 40 nucleotides of cytosine, and g) optionally a histone stem-loop structure, optionally comprising or consisting of a nucleic acid sequence corresponding to SEQ ID NO: 3079 or 3080.
[31]
31. Composition, characterized in that it comprises at least one artificial nucleic acid molecule, preferably RNA, according to any one of claims 1 to 30, and a pharmaceutically acceptable carrier and/or excipient.
[32]
A composition according to claim 31, comprising a plurality of at least two artificial nucleic acid molecules, according to any one of claims 1 to 30, characterized in that preferably at least two of said plurality of artificial nucleic acid molecules encoding 870190141603, of 12/30/2019, p. 22352/22358 cam a different antigenic peptide or protein, optionally selected from an antigenic peptide or protein as defined in claim 5, 6 or 7, or a fragment, variant or derivative thereof.
[33]
33. Composition according to claim 31 or 32, characterized in that said composition is a pharmaceutical composition, optionally a vaccine.
[34]
34. Composition (pharmaceutical) or vaccine, according to claim 33, characterized in that the artificial nucleic acid molecule, preferably RNA, is complexed with one or more cationic or polycationic compounds, preferably with cationic or polycationic polymers, peptides or cationic or polycationic proteins, eg protamine, cationic or polycationic polysaccharides and/or cationic or polycationic lipids.
[35]
35. Composition (pharmaceutical) or vaccine, according to claim 34, characterized in that the cationic or polycationic compound is a polymeric vehicle.
[36]
36. Composition (pharmaceutical) or vaccine, according to claim 34, characterized in that the N/P ratio of the artificial nucleic acid molecule, preferably RNA, for the one or more cationic or polycationic compounds is in the range from about 0.1 to 10, including a range from about 0.3 to 4, from about 0.5 to 2, from about 0.7 to 2, and from about 0.7 to 1.5.
[37]
37. Composition (pharmaceutical) or vaccine, according to any one of claims 31 to 36, characterized in that the artificial nucleic acid molecule, preferably RNA, is complexed with one or more lipids, thus forming lipid nanoparticles, lipoplexes and/or preferably liposomes.
[38]
38. Composition (pharmaceutical) or vaccine, according to any one of claims 31 to 37, characterized in that 'edition 870190141603, of 12/30/2019, p. 22353/22358 that said composition further comprises a non-coding RNA selected from the group consisting of low interference RNA (SiRNA), antisense RNA (asRNA), circular RNA (circRNA), ribozymes, aptamers, riboswitches, immunostimulating RNA (isRNA) , transfer RNA (tRNA), ribosomal RNA (rRNA), small nuclear RNA (SNRNA), small nucleolar RNA (snoRNA), microRNA (mIiRNA), and Piwi-interacting RNA (piRNA).
[39]
39. Composition (pharmaceutical) or vaccine, according to claim 38, characterized in that the immunostimulatory RNA comprises at least one RNA sequence according to formula (IS-1) (GXmGn), formula (IS -II) (CIXmCn), formula (IS-III) (Nu GIXmGnNy)a, and/or formula (IS-IV) (N.CiXmCnNy)a).
[40]
40. Composition (pharmaceutical) or vaccine, according to claim 39, characterized in that the immunostimulatory RNA comprises at least one RNA sequence corresponding to any one of SEQ ID NOs: 2938 - 3032.
[41]
41. Composition (pharmaceutical) or vaccine, according to any one of claims 31 to 40, characterized in that the composition comprises a polymeric carrier complex, formed by a polymeric carrier, preferably comprising cross-linked cationic peptides by disulfide, preferably Cys-Arg12 and/or Cys-Arg12-Cys, and an isRNA, preferably comprising or consisting of an RNA sequence corresponding to SEQ ID NOs: 2938 - 3032.
[42]
42. Kit, preferably kit of parts, characterized in that it comprises the artificial nucleic acid molecule, preferably RNA, according to any one of claims 1 to 30, or the (pharmaceutical) composition or vaccine, according to any one of claims 31 to 41, and optionally a liquid vehicle and/or optionally technical instructions with information on issue 870190141603, dated 12/30/2019, p. 22354/22358 administering and dosing the artificial nucleic acid molecule or composition.
[43]
An artificial nucleic acid molecule, preferably RNA, according to any one of claims 1 to 30, a (pharmaceutical) composition or vaccine, according to any one of claims 31 to 41, or a kit, according to any of claims 31 to 41. claim 42, characterized by the fact that it is for use as a medicine.
[44]
An artificial nucleic acid molecule, preferably RNA, according to any one of claims 1 to 30, a (pharmaceutical) composition or vaccine, according to any one of claims 31 to 41, or a kit, according to claim 42, characterized in that it is for use in a method of treatment or prophylaxis of cancer, infectious diseases including viral, bacterial, fungal or protozoal infections, autoimmune diseases, graft versus host disease (GvHD) or allergies.
[45]
45. Artificial nucleic acid molecule, preferably RNA, for use according to claim 44, characterized in that said use comprises (a) administering, to an individual in need thereof, said artificial nucleic acid molecule - official, preferably RNA, said (pharmaceutical) composition or vaccine, or said kit.
[46]
46. Artificial nucleic acid molecule, preferably RNA, for use, according to claim 45, characterized in that the administration is carried out parenterally, preferably intradermally, subcutaneously, intravenously, intramuscularly, intranodally. , transdermal or intratumoral.
[47]
47. Method of treating or preventing cancer, autoimmune diseases or infectious diseases including infections by viruses, bacteria, fungi or protozoa, characterized in that it comprises administering, to a patient in need thereof, an 'edition 870190141603 , of 12/30/2019, p. effective amount of the artificial nucleic acid molecule, preferably RNA, according to any one of claims 1 to 30, of the (pharmaceutical) composition or vaccine according to any one of claims 31 to 41, or the kit , according to the claim
42.
[48]
48. Use according to any one of claims 44 to 46, or method according to claim 47, characterized in that it further comprises subjecting the patient to at least one or more of the following additional therapies: chemotherapy (for example , first-line or second-line chemotherapy), radiotherapy, chemoradiation (combination of chemotherapy and radiotherapy), kinase inhibitors, antibody therapy and/or checkpoint modulators (e.g. CTLAA inhibitors, of PD1) or inhibitors that induce the expression of T cell epitopes associated with defective peptide processing (TEIPPs).
[49]
49. Use according to claim 48, characterized in that said additional therapy is carried out before, simultaneously or subsequent to the administration of said artificial nucleic acid molecule, (pharmaceutical) composition or vaccine or kit.
[50]
50. A method of cell treatment or cell culture in vitro, characterized in that it comprises (a) providing cells in vitro, (b) contacting said cells with the artificial nucleic acid molecule, preferably RNA, according to any of the claims 1 to 30, the (pharmaceutical) composition or vaccine according to any one of claims 31 to 41, or the kit according to claim 42.
'edition 870190141603, of 12/30/2019, page 22356/22358

类似技术:

---

公开号 | 公开日 | 专利标题

---

US10988754B2|2021-04-27|Nucleic acid molecules

---

KR20190110612A|2019-09-30|Immunomodulatory Therapeutic MRNA Compositions Encoding Activating Oncogene Mutant Peptides

---

CN108430456B|2022-01-18|Cancer vaccine

---

JP2020506189A|2020-02-27|RNA cancer vaccine

---

US20210205434A1|2021-07-08|Zika virus vaccine

---

US20200254086A1|2020-08-13|Efficacious mrna vaccines

---

KR20190008890A|2019-01-25|Polynucleotides encoding interleukin-12 | and uses thereof

---

US11141474B2|2021-10-12|Artificial nucleic acid molecules encoding a norovirus antigen and uses thereof

---

KR20160042935A|2016-04-20|Composition and Vaccine for Treating Lung Cancer

---

AU2017266929A1|2019-01-17|Combinations of mRNAs encoding immune modulating polypeptides and uses thereof

---

WO2019077001A1|2019-04-25|Novel artificial nucleic acid molecules

---

US20200085944A1|2020-03-19|Rna vaccine and immune checkpoint inhibitors for combined anticancer therapy

---

KR20190039969A|2019-04-16|RNA for cancer therapy

---

US20190351044A1|2019-11-21|Lassa virus vaccine

---

WO2018129270A1|2018-07-12|Systems and methods to improve vaccine efficacy

---

US20190351047A1|2019-11-21|Henipavirus vaccine

---

KR20210135494A|2021-11-15|Method for preparing lipid nanoparticles

---

WO2017030956A1|2017-02-23|Method of inducing a t-cell response to phosphopeptides using nucleic acids encoding phosphopeptide mimetics

---

US20200208145A1|2020-07-02|Modified messenger rna comprising functional rna elements

---

US20200369748A1|2020-11-26|Polynucleotides encoding anti-chikungunya virus antibodies

---

EP3965830A1|2022-03-16|Differentially expressed immune cell micrornas for regulation of protein expression

---

WO2020097409A9|2020-06-18|Use of mrna encoding ox40l to treat cancer in human patients

---

WO2008070858A1|2008-06-12|Inhibiting translation of abrerrant dnmt3b transcripts in cancer cells using inhibitory nucleic acids

同族专利:

---

公开号 | 公开日

---

CN111328287A|2020-06-23|

---

JP2020530980A|2020-11-05|

---

CA3066932A1|2019-01-10|

---

RU2020103379A3|2021-12-07|

---

SG11201911430PA|2020-01-30|

---

EP3424524A3|2019-02-27|

---

US20210198649A1|2021-07-01|

---

AU2018298422A1|2019-12-19|

---

US10988754B2|2021-04-27|

---

KR20200024905A|2020-03-09|

---

US20190040378A1|2019-02-07|

---

RU2020103379A|2021-08-04|

---

EP3648791A1|2020-05-13|

---

WO2019008001A1|2019-01-10|

---

EP3424524A2|2019-01-09|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

AU649066B2|1990-07-25|1994-05-12|Syngene, Inc.|Circular extension for generating multiple nucleic acid complements|

---

US5773244A|1993-05-19|1998-06-30|Regents Of The University Of California|Methods of making circular RNA|

---

WO1995007707A1|1993-09-14|1995-03-23|Cytel Corporation|Alteration of immune response using pan dr-binding peptides|

---

US5534499A|1994-05-19|1996-07-09|The University Of British Columbia|Lipophilic drug derivatives for use in liposomes|

---

US5885613A|1994-09-30|1999-03-23|The University Of British Columbia|Bilayer stabilizing components and their use in forming programmable fusogenic liposomes|

---

US5820873A|1994-09-30|1998-10-13|The University Of British Columbia|Polyethylene glycol modified ceramide lipids and liposome uses thereof|

---

US7112329B1|1996-06-14|2006-09-26|Meiji Milk Products Co. Ltd.|T cell epitope peptide|

---

DE69840326D1|1997-03-27|2009-01-22|Csl Ltd|INCREASING IMMUNE RESPONSE USING TARGETED MOLECULES|

---

US6320017B1|1997-12-23|2001-11-20|Inex Pharmaceuticals Corp.|Polyamide oligomers|

---

US6534482B1|1998-05-13|2003-03-18|Epimmune, Inc.|Expression vectors for stimulating an immune response and methods of using the same|

---

US6210931B1|1998-11-30|2001-04-03|The United States Of America As Represented By The Secretary Of Agriculture|Ribozyme-mediated synthesis of circular RNA|

---

AU6620300A|1999-08-03|2001-02-19|Ohio State University, The|Polypeptides and polynucleotides for enhancing immune reactivity to her-2 protein|

---

CN1279971C|2000-02-21|2006-10-18|法麦克萨有限公司|Novel method for down-regulation of amyloid|

---

US7342002B2|2000-08-03|2008-03-11|The Johns Hopkins University|Molecular vaccine linking an endoplasmic chaperone polypeptide to an antigen|

---

US20030138769A1|2000-08-16|2003-07-24|Birkett Ashley J.|Immunogenic HBc chimer particles having enhanced stability|

---

US20030091590A1|2001-01-17|2003-05-15|Pomerantz Roger J.|Recombinant rhabdoviruses as live-viral vaccines|

---

EP1379552B2|2001-04-20|2014-11-19|The Institute for Systems Biology|Toll-like receptor 5 ligands and methods of use|

---

DE50214379D1|2001-06-05|2010-05-27|Curevac Gmbh|Stabilized mRNA with elevated G / C content for gene therapy|

---

DE10162480A1|2001-12-19|2003-08-07|Ingmar Hoerr|The application of mRNA for use as a therapeutic agent against tumor diseases|

---

WO2004000873A2|2002-06-25|2003-12-31|City Of Hope|Adjuvant-free peptide vaccine|

---

DE10229872A1|2002-07-03|2004-01-29|Curevac Gmbh|Immune stimulation through chemically modified RNA|

---

EP1572116A4|2002-11-26|2007-12-12|Genentech Inc|Compositions and methods for the treatment of immune related diseases|

---

CU23204A1|2002-12-27|2007-05-18|Ct Ingenieria Genetica Biotech|COMBINATIONS OF REGULATORY FACTORS OF GROWTH AND HORMONES FOR THE TREATMENT OF NEOPLASIAS|

---

DE10335833A1|2003-08-05|2005-03-03|Curevac Gmbh|Transfection of blood cells with mRNA for immune stimulation and gene therapy|

---

DE10347710B4|2003-10-14|2006-03-30|Johannes-Gutenberg-Universität Mainz|Recombinant vaccines and their use|

---

DE102004042546A1|2004-09-02|2006-03-09|Curevac Gmbh|Combination therapy for immune stimulation|

---

EP1874343A4|2005-04-19|2009-07-22|Lilly Co Eli|Monovalent and polyvalent synthetic polysaccharide antigens for immunological intervention in disease|

---

DE102005023170A1|2005-05-19|2006-11-23|Curevac Gmbh|Optimized formulation for mRNA|

---

PT2578685T|2005-08-23|2019-07-10|Univ Pennsylvania|Rna containing modified nucleosides and methods of use thereof|

---

CN101448848B|2006-03-27|2013-12-04|全球免疫股份有限公司|Ras mutation and compositions and methods related thereto|

---

CA2659301A1|2006-07-28|2008-02-07|Applera Corporation|Dinucleotide mrna cap analogs|

---

DE102006035618A1|2006-07-31|2008-02-07|Curevac Gmbh|New nucleic acid useful as immuno-stimulating adjuvant for manufacture of a composition for treatment of cancer diseases e.g. colon carcinomas and infectious diseases e.g. influenza and malaria|

---

US9249202B2|2006-08-11|2016-02-02|Life Sciences Research Partners Vzw|Immunogenic peptides and their use in immune disorders|

---

DE102006061015A1|2006-12-22|2008-06-26|Curevac Gmbh|Process for the purification of RNA on a preparative scale by HPLC|

---

US20100189729A1|2007-01-09|2010-07-29|Curvac Gmbh|Rna-coded antibody|

---

PL2167523T3|2007-06-19|2014-12-31|Univ Louisiana State|Synthesis and use of anti-reverse phosphorothioate analogs of the messenger rna cap|

---

WO2009030254A1|2007-09-04|2009-03-12|Curevac Gmbh|Complexes of rna and cationic peptides for transfection and for immunostimulation|

---

WO2009046738A1|2007-10-09|2009-04-16|Curevac Gmbh|Composition for treating lung cancer, particularly of non-small lung cancers |

---

WO2009046739A1|2007-10-09|2009-04-16|Curevac Gmbh|Composition for treating prostate cancer |

---

JP5749494B2|2008-01-02|2015-07-15|テクミラ ファーマシューティカルズ コーポレイション|Improved compositions and methods for delivery of nucleic acids|

---

PT2176408E|2008-01-31|2015-04-23|Curevac Gmbh|Nucleic acids comprising formula a and derivatives thereof as an immunostimulating agents /adjuvants|

---

US8058069B2|2008-04-15|2011-11-15|Protiva Biotherapeutics, Inc.|Lipid formulations for nucleic acid delivery|

---

PL215513B1|2008-06-06|2013-12-31|Univ Warszawski|New borane phosphate analogs of dinucleotides, their application, RNA particle, method of obtaining RNA and method of obtaining peptides or protein|

---

EP2161279A1|2008-08-29|2010-03-10|Centre National de la Recherche Scientifique|Synthetic peptides corresponding to overlapping neutralizing determinants in the CBD1 epitope induce broadly neutralizing antibodies|

---

WO2010037408A1|2008-09-30|2010-04-08|Curevac Gmbh|Composition comprising a complexed rna and a naked mrna for providing or enhancing an immunostimulatory response in a mammal and uses thereof|

---

EP2350043B9|2008-10-09|2014-08-20|TEKMIRA Pharmaceuticals Corporation|Improved amino lipids and methods for the delivery of nucleic acids|

---

WO2010048536A2|2008-10-23|2010-04-29|Alnylam Pharmaceuticals, Inc.|Processes for preparing lipids|

---

WO2010053572A2|2008-11-07|2010-05-14|Massachusetts Institute Of Technology|Aminoalcohol lipidoids and uses thereof|

---

WO2010054401A1|2008-11-10|2010-05-14|Alnylam Pharmaceuticals, Inc.|Novel lipids and compositions for the delivery of therapeutics|

---

WO2010087791A1|2009-01-27|2010-08-05|Utc Power Corporation|Distributively cooled, integrated water-gas shift reactor and vaporizer|

---

CA2751342C|2009-01-29|2019-05-07|Alnylam Pharmaceuticals, Inc.|Lipid formulations comprising cationic lipid and a targeting lipid comprising n-acetyl galactosamine for delivery of nucleic acid|

---

US8467858B2|2009-04-29|2013-06-18|Tomophase Corporation|Image-guided thermotherapy based on selective tissue thermal treatment|

---

CA2760776C|2009-05-05|2019-07-09|Alnylam Pharmaceuticals, Inc.|Lipid compositions for the delivery of therapeutic agents|

---

LT3431076T|2009-06-10|2021-10-25|Arbutus Biopharma Corporation|Improved lipid formulation|

---

EP2281579A1|2009-08-05|2011-02-09|BioNTech AG|Vaccine composition comprising 5'-Cap modified RNA|

---

US20110053829A1|2009-09-03|2011-03-03|Curevac Gmbh|Disulfide-linked polyethyleneglycol/peptide conjugates for the transfection of nucleic acids|

---

WO2011069529A1|2009-12-09|2011-06-16|Curevac Gmbh|Mannose-containing solution for lyophilization, transfection and/or injection of nucleic acids|

---

CN104959052B|2010-04-09|2018-07-13|帕西拉制药有限公司|The method for synthesizing membrane vesicle for preparing major diameter|

---

KR101967411B1|2010-06-03|2019-04-10|알닐람 파마슈티칼스 인코포레이티드|Biodegradable lipids for the delivery of active agents|

---

CA2804396C|2010-07-06|2021-06-29|Novartis Ag|Liposomes with lipids having an advantageous pka-value for rna delivery|

---

NZ606591A|2010-07-06|2015-02-27|Novartis Ag|Cationic oil-in-water emulsions|

---

DK2449113T3|2010-07-30|2016-01-11|Curevac Ag|Complex formation of nucleic acids with the disulfide cross-linked cationic components for transfection and immunostimulation|

---

WO2012019630A1|2010-08-13|2012-02-16|Curevac Gmbh|Nucleic acid comprising or coding for a histone stem-loop and a poly sequence or a polyadenylation signal for increasing the expression of an encoded protein|

---

EP2611420B1|2010-08-31|2019-03-27|GlaxoSmithKline Biologicals SA|Lipids suitable for liposomal delivery of protein-coding rna|

---

MX341989B|2010-08-31|2016-09-09|Novartis Ag |Small liposomes for delivery of immunogen-encoding rna.|

---

JP5911870B2|2010-08-31|2016-04-27|ノバルティス アーゲー|PEGylated liposomes for delivery of RNA encoding immunogens|

---

WO2012089225A1|2010-12-29|2012-07-05|Curevac Gmbh|Combination of vaccination and inhibition of mhc class i restricted antigen presentation|

---

WO2012113413A1|2011-02-21|2012-08-30|Curevac Gmbh|Vaccine composition comprising complexed immunostimulatory nucleic acids and antigens packaged with disulfide-linked polyethyleneglycol/peptide conjugates|

---

WO2012116715A1|2011-03-02|2012-09-07|Curevac Gmbh|Vaccination in newborns and infants|

---

WO2012116714A1|2011-03-02|2012-09-07|Curevac Gmbh|Vaccination in elderly patients|

---

MX350764B|2011-07-06|2017-09-18|Novartis Ag|Liposomes having useful n:p ratio for delivery of rna molecules.|

---

RU2628705C2|2011-08-31|2017-08-21|Новартис Аг|Pegylated liposomes for immunougen-coding rna delivery|

---

US8969545B2|2011-10-18|2015-03-03|Life Technologies Corporation|Alkynyl-derivatized cap analogs, preparation and uses thereof|

---

EP2623121A1|2012-01-31|2013-08-07|Bayer Innovation GmbH|Pharmaceutical composition comprising a polymeric carrier cargo complex and an antigen|

---

WO2013113326A1|2012-01-31|2013-08-08|Curevac Gmbh|Pharmaceutical composition comprising a polymeric carrier cargo complex and at least one protein or peptide antigen|

---

WO2013113325A1|2012-01-31|2013-08-08|Curevac Gmbh|Negatively charged nucleic acid comprising complexes for immunostimulation|

---

WO2013120497A1|2012-02-15|2013-08-22|Curevac Gmbh|Nucleic acid comprising or coding for a histone stem-loop and a poly sequence or a polyadenylation signal for increasing the expression of an encoded therapeutic protein|

---

WO2013120498A1|2012-02-15|2013-08-22|Curevac Gmbh|Nucleic acid comprising or coding for a histone stem-loop and a poly sequence or a polyadenylation signal for increasing the expression of an encoded allergenic antigen or an autoimmune self-antigen|

---

WO2013120500A1|2012-02-15|2013-08-22|Curevac Gmbh|Nucleic acid comprising or coding for a histone stem-loop and a poly sequence or a polyadenylation signal for increasing the expression of an encoded tumour antigen|

---

WO2013120499A1|2012-02-15|2013-08-22|Curevac Gmbh|Nucleic acid comprising or coding for a histone stem-loop and a poly sequence or a polyadenylation signal for increasing the expression of an encoded pathogenic antigen|

---

MX358706B|2012-03-27|2018-08-31|Curevac Ag|Artificial nucleic acid molecules comprising a 5'top utr.|

---

SG10201607962RA|2012-03-27|2016-11-29|Curevac Ag|Artificial nucleic acid molecules|

---

SG10201607968WA|2012-03-27|2016-12-29|Curevac Ag|Artificial nucleic acid molecules for improved protein or peptide expression|

---

GB2502127A|2012-05-17|2013-11-20|Kymab Ltd|Multivalent antibodies and in vivo methods for their production|

---

WO2013174409A1|2012-05-25|2013-11-28|Curevac Gmbh|Reversible immobilization and/or controlled release of nucleic acid containing nanoparticles by polymer coatings|

---

AU2013204922B2|2012-12-20|2015-05-14|Celgene Corporation|Chimeric antigen receptors|

---

CA2897858A1|2013-02-22|2014-08-28|Curevac Gmbh|Combination of vaccination and inhibition of the pd-1 pathway|

---

EA037217B1|2013-08-21|2021-02-20|Куревак Аг|Composition and vaccine for treating lung cancer|

---

BR112016000889A2|2013-08-21|2017-12-12|Curevac Ag|composition and vaccine for prostate cancer treatment|

---

CN105517569A|2013-08-21|2016-04-20|库瑞瓦格股份公司|Rabies vaccine|

---

JP6648019B2|2013-08-21|2020-02-14|キュアバック アーゲー|Pharmaceutical compositions for promoting expression of RNA-encoded proteins, use of modified RNA for the manufacture of pharmaceutical compositions, and kits of parts comprising the pharmaceutical compositions|

---

WO2015024669A1|2013-08-21|2015-02-26|Curevac Gmbh|Combination vaccine|

---

RU2723328C2|2013-08-21|2020-06-09|Куревак Аг|Vaccine against respiratory syncytial virus |

---

EP3041938A1|2013-09-03|2016-07-13|Moderna Therapeutics, Inc.|Circular polynucleotides|

---

CA2925021A1|2013-11-01|2015-05-07|Curevac Ag|Modified rna with decreased immunostimulatory properties|

---

EP3071547A1|2013-11-18|2016-09-28|Arcturus Therapeutics, Inc.|Ionizable cationic lipid for rna delivery|

---

GB201321384D0|2013-12-04|2014-01-15|Isis Innovation|Molecular adjuvant|

---

WO2015100219A1|2013-12-23|2015-07-02|Oncomed Pharmaceuticals, Inc.|Immunotherapy with binding agents|

---

JP6584414B2|2013-12-30|2019-10-02|キュアバック アーゲー|Artificial nucleic acid molecule|

---

SG11201604198YA|2013-12-30|2016-07-28|Curevac Ag|Methods for rna analysis|

---

JP6704850B2|2013-12-30|2020-06-03|キュアバック アーゲー|Artificial nucleic acid molecule|

---

EP3116535B1|2014-03-12|2019-08-07|CureVac AG|Combination of vaccination and ox40 agonists|

---

US10369216B2|2014-04-01|2019-08-06|Curevac Ag|Polymeric carrier cargo complex for use as an immunostimulating agent or as an adjuvant|

---

PL3155129T3|2014-06-10|2019-09-30|Curevac Ag|Method for enhancing rna production|

---

CN111454165A|2014-06-25|2020-07-28|爱康泰生治疗公司|Novel lipid and lipid nanoparticle formulations for delivery of nucleic acids|

---

CA2955238A1|2014-07-16|2016-01-21|Moderna Therapeutics, Inc.|Circular polynucleotides|

---

EP3230458B1|2014-12-12|2020-02-19|CureVac AG|Artificial nucleic acid molecules for improved protein expression|

---

WO2016097065A1|2014-12-16|2016-06-23|Curevac Ag|Ebolavirus and marburgvirus vaccines|

---

CN107124889A|2014-12-30|2017-09-01|库瑞瓦格股份公司|Artificial nucleic acid molecule|

---

EP3283059A1|2015-04-13|2018-02-21|CureVac AG|Method for producing rna compositions|

---

US10780054B2|2015-04-17|2020-09-22|Curevac Real Estate Gmbh|Lyophilization of RNA|

---

ES2746340T3|2015-04-22|2020-03-05|Curevac Ag|Composition containing RNA for the treatment of tumor diseases|

---

EP3289101B1|2015-04-30|2021-06-23|CureVac AG|Immobilized polypolymerase|

---

WO2016174227A1|2015-04-30|2016-11-03|Curevac Ag|Method for in vitro transcription using an immobilized restriction enzyme|

---

WO2016180430A1|2015-05-08|2016-11-17|Curevac Ag|Method for producing rna|

---

SG10201910433VA|2015-05-15|2020-01-30|Curevac Ag|Prime-boost regimens involving administration of at least one mrna construct|

---

EP3298142B1|2015-05-20|2021-07-14|CureVac AG|Dry powder composition comprising long-chain rna|

---

EP3297682B1|2015-05-20|2021-07-14|CureVac AG|Dry powder composition comprising long-chain rna|

---

US20180237817A1|2015-05-29|2018-08-23|Curevac Ag|Method for adding cap structures to rna using immobilized enzymes|

---

ES2798271T3|2015-05-29|2020-12-10|Curevac Real Estate Gmbh|Method for producing and purifying RNA, comprising at least one tangential flow filtration step|

---

WO2016203025A1|2015-06-17|2016-12-22|Curevac Ag|Vaccine composition|

---

EP3317424A1|2015-07-01|2018-05-09|CureVac AG|Method for analysis of an rna molecule|

---

US10501768B2|2015-07-13|2019-12-10|Curevac Ag|Method of producing RNA from circular DNA and corresponding template DNA|

---

EP3331555A1|2015-08-05|2018-06-13|CureVac AG|Epidermal mrna vaccine|

---

EP3699288A1|2015-08-07|2020-08-26|CureVac AG|Process for the in vivo production of rna in a host cell|

---

EP3825407A1|2015-08-10|2021-05-26|CureVac Real Estate GmbH|Method of increasing the replication of a circular dna molecule|

---

HUE055458T2|2015-09-21|2021-11-29|Trilink Biotechnologies Llc|Compositions and methods for synthesizing 5'-capped rnas|

---

EP3362576A1|2015-10-12|2018-08-22|CureVac AG|Automated method for isolation, selection and/or detection of microorganisms or cells comprised in a solution|

---

AU2016340183A1|2015-10-16|2018-04-19|Modernatx, Inc.|mRNA cap analogs and methods of mRNA capping|

---

WO2017066791A1|2015-10-16|2017-04-20|Modernatx, Inc.|Sugar substituted mrna cap analogs|

---

WO2017066789A1|2015-10-16|2017-04-20|Modernatx, Inc.|Mrna cap analogs with modified sugar|

---

EP3362461B1|2015-10-16|2022-03-16|Modernatx, Inc.|Mrna cap analogs with modified phosphate linkage|

---

WO2017066782A1|2015-10-16|2017-04-20|Modernatx, Inc.|Hydrophobic mrna cap analogs|

---

WO2017066797A1|2015-10-16|2017-04-20|Modernatx, Inc.|Trinucleotide mrna cap analogs|

---

EP3374504A2|2015-11-09|2018-09-19|CureVac AG|Optimized nucleic acid molecules|

---

US20190160164A1|2015-11-09|2019-05-30|Curevac Ag|Rotavirus vaccines|

---

US20180371392A1|2015-12-21|2018-12-27|Curevac Ag|Inlay for a culture plate and corresponding method for preparing a culture plate system with such inlay|

---

JP2019508371A|2015-12-22|2019-03-28|モデルナティエックス インコーポレイテッドＭｏｄｅｒｎａＴＸ，Ｉｎｃ．|Compounds and compositions for intracellular delivery of drugs|

---

KR20180107109A|2015-12-22|2018-10-01|큐어백 아게|Method for producing RNA molecular composition|

---

EP3394280A1|2015-12-23|2018-10-31|CureVac AG|Method of rna in vitro transcription using a buffer containing a dicarboxylic acid or tricarboxylic acid or a salt thereof|

---

US9834510B2|2015-12-30|2017-12-05|Arcturus Therapeutics, Inc.|Aromatic ionizable cationic lipid|

---

US20210180106A1|2016-02-12|2021-06-17|Curevac Ag|Method for analyzing rna|

---

WO2017140345A1|2016-02-15|2017-08-24|Curevac Ag|Method for analyzing by-products of rna in vitro transcription|

---

SG11201806340YA|2016-02-17|2018-09-27|Curevac Ag|Zika virus vaccine|

---

US20190100784A1|2016-03-03|2019-04-04|Curevac Ag|Rna analysis by total hydrolysis|

---

WO2017162297A1|2016-03-24|2017-09-28|Curevac Ag|Immobilized inorganic pyrophosphatase |

---

US20180237789A1|2016-04-16|2018-08-23|Jiangnan University|Mortierella alpine uracil auxotroph with ura5 gene knocked out through homologous recombination|

---

EP3777881A1|2016-04-22|2021-02-17|CureVac AG|Rna encoding a tumor antigen|

---

EP3448427A1|2016-04-29|2019-03-06|CureVac AG|Rna encoding an antibody|

---

WO2017191258A1|2016-05-04|2017-11-09|Curevac Ag|Influenza mrna vaccines|

---

EP3452493A1|2016-05-04|2019-03-13|CureVac AG|Nucleic acid molecules and uses thereof|

---

WO2017191274A2|2016-05-04|2017-11-09|Curevac Ag|Rna encoding a therapeutic protein|

---

US20180126003A1|2016-05-04|2018-05-10|Curevac Ag|New targets for rna therapeutics|

---

WO2017203008A1|2016-05-25|2017-11-30|Curevac Ag|Novel biomarkers|

---

CN109475640A|2016-06-09|2019-03-15|库瑞瓦格股份公司|Nucleic acid is carried the mixing carrier of object|

---

EP3468609A1|2016-06-09|2019-04-17|CureVac AG|Cationic carriers for nucleic acid delivery|

---

EP3468612A1|2016-06-09|2019-04-17|CureVac AG|Hybrid carriers for nucleic acid cargo|

---

WO2017212006A1|2016-06-09|2017-12-14|Curevac Ag|Hybrid carriers for nucleic acid cargo|

---

RU2019106989A3|2016-08-19|2021-04-05|

---

US20190241925A1|2016-09-26|2019-08-08|SOLA Biosciences, LLC|Cell-Associated Secretion-Enhancing Fusion Proteins|

---

US10487105B2|2016-10-19|2019-11-26|Arcturus Therapeutics, Inc.|Trinucleotide MRNA cap analogs|

---

BR112019008481A2|2016-10-26|2020-03-03|Curevac Ag|LIPID NANOPARTICLE MRNA VACCINES|EP3362576A1|2015-10-12|2018-08-22|CureVac AG|Automated method for isolation, selection and/or detection of microorganisms or cells comprised in a solution|

---

EP3394280A1|2015-12-23|2018-10-31|CureVac AG|Method of rna in vitro transcription using a buffer containing a dicarboxylic acid or tricarboxylic acid or a salt thereof|

---

WO2017191274A2|2016-05-04|2017-11-09|Curevac Ag|Rna encoding a therapeutic protein|

---

EP3452493A1|2016-05-04|2019-03-13|CureVac AG|Nucleic acid molecules and uses thereof|

---

EP3558356A2|2016-12-23|2019-10-30|CureVac AG|Mers coronavirus vaccine|

---

CN108728477B|2017-04-24|2022-02-22|华东理工大学|Efficient transposition mutation system and construction method|

---

EP3645557A4|2017-06-28|2021-07-14|The Cleveland Clinic Foundation|Treatment of nervous system injury and neurodegenerative disorders and related conditions|

---

TW202039534A|2018-12-14|2020-11-01|美商美國禮來大藥廠|Kras variant mrna molecules|

---

WO2020172296A1|2019-02-19|2020-08-27|Board Of Regents, The University Of Texas System|Hipk inhibitors and methods of use thereof|

---

CN111620934B|2019-02-26|2022-03-08|中国科学院遗传与发育生物学研究所|Application of protein GmHSFB2b in regulation and control of accumulation of plant flavonoids|

---

WO2021000953A1|2019-07-04|2021-01-07|江苏康宁杰瑞生物制药有限公司|Substance and method for treating tumor|

---

CN112175062A|2019-07-05|2021-01-05|中国医学科学院基础医学研究所|SFT2B protein linear epitope and application thereof in schizophrenia diagnosis|

---

WO2021117009A2|2019-12-11|2021-06-17|Moore Tara|Allele-specific silencing of transforming growth factor beta induced gene with r124h mutation using short interfering rna|

---

CN111057690A|2019-12-23|2020-04-24|维塔恩医药有限公司|Tumor-associated gene BRAF mutation-associated antigen short peptide and application thereof|

---

US11241493B2|2020-02-04|2022-02-08|Curevac Ag|Coronavirus vaccine|

---

WO2021204179A1|2020-04-09|2021-10-14|Suzhou Abogen Biosciences Co., Ltd.|Nucleic acid vaccines for coronavirus|

---

US20220002716A1|2020-07-02|2022-01-06|Life Technologies Corporation|Trinucleotide cap analogs, preparation and uses thereof|

---

CN112011564A|2020-09-04|2020-12-01|西南大学|Novel cryptococcus nuclear indication vector and construction method and application thereof|

---

CN112480232A|2020-12-14|2021-03-12|上海交通大学|Bioactive peptide VSLADLQNDEVAFR, and preparation method and application thereof|

---

CN112575003B|2020-12-17|2022-02-15|中国农业科学院植物保护研究所|Application of HAKAI gene of Nicotiana benthamiana in regulation and control of plant virus resistance and transgenic plant cultivation method|

---

CN112662680A|2020-12-31|2021-04-16|浙江大学|Tomato yellow-green-turning gene SlRHBDD2 and application thereof|

---

CN112794901B|2021-01-08|2022-01-04|南通大学附属医院|anti-SMIM 15 monoclonal antibody and application thereof|

---

CN112362432B|2021-01-12|2021-04-09|广州科方生物技术股份有限公司|Dissociation agent universally used in serum TT3 and TT4 and preparation method thereof|

---

CN113533589B|2021-09-16|2021-12-17|天九再生医学科技有限公司|Method for analyzing exosomal charge heterogeneity|

法律状态:
2021-11-03| B350| Update of information on the portal [chapter 15.35 patent gazette]|

优先权:

---

申请号 | 申请日 | 专利标题

---

EPPCT/EP2017/066676|2017-07-04|

---

EPPCT/EP2017/066676|2017-07-04|

---

PCT/EP2018/068015|WO2019008001A1|2017-07-04|2018-07-03|Novel nucleic acid molecules|

---